EMAIL THIS PAGE TO A FRIEND

CCNE2

cyclin E2

146 Gene Product Result for
Synonyms: CYCE2
UniProtKB ID: O96020, O95439
Gene ID:
Human(9134) Summary: The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with and functions as a regulatory subunit of CDK2. This cyclin has been shown to specifically interact with CIP/KIP family of CDK inhibitors, and plays a role in cell cycle G1/S transition. The expression of this gene peaks at the G1-S phase and exhibits a pattern of tissue specificity distinct from that of cyclin E1. A significantly increased expression level of this gene was observed in tumor-derived cells. [provided by RefSeq, Jul 2008]
Mouse(12448) cyclin E2
Rat(362485) cyclin E2
Zebrafish(415165) cyclin E2
cow(538436) cyclin E2
Horse(100055302) cyclin E2
dog(487057) cyclin E2
chicken(420231) cyclin E2
sheep(101109811) cyclin E2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009830 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009830 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009830 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004702 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004702 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004702 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_057735 Rosetta Predictions human pricing
NM_057749 Rosetta Predictions human pricing
NM_001108656 Rosetta Predictions rat pricing
NM_001037134 Rosetta Predictions mouse pricing
NM_009830 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057735 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025827 predicted 1227
2 SASI_Hs01_00025828 predicted 359
3 SASI_Hs01_00025829 predicted 360
4 SASI_Hs01_00025830 predicted 1137
5 SASI_Hs01_00025831 predicted 327
6 SASI_Hs01_00025832 predicted 268
7 SASI_Hs01_00025833 predicted 889
8 SASI_Hs01_00025834 predicted 1240
9 SASI_Hs01_00025835 predicted 255
10 SASI_Hs01_00025836 predicted 1233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057749 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228284 predicted 1357
2 SASI_Hs01_00228286 predicted 354
3 SASI_Hs01_00228287 predicted 1264
4 SASI_Hs02_00362052 predicted 560
5 SASI_Hs01_00228288 predicted 320
6 SASI_Hs01_00228289 predicted 264
7 SASI_Hs02_00362053 predicted 773
8 SASI_Hs02_00362054 predicted 657
9 SASI_Hs02_00362055 predicted 785
10 SASI_Hs01_00228292 predicted 258
11 SASI_Hs01_00228285 predicted 355
12 SASI_Hs01_00228290 predicted 1031
13 SASI_Hs01_00228291 predicted 1380
14 SASI_Hs01_00228293 predicted 1372
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108656 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240779 predicted 312
2 SASI_Rn02_00240780 predicted 278
3 SASI_Rn02_00240781 predicted 1271
4 SASI_Rn02_00240782 predicted 267
5 SASI_Rn02_00240783 predicted 360
6 SASI_Rn02_00240784 predicted 872
7 SASI_Rn02_00240785 predicted 1280
8 SASI_Rn02_00240786 predicted 967
9 SASI_Rn02_00240787 predicted 663
10 SASI_Rn02_00240788 predicted 868
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037134 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194369 predicted 1157
2 SASI_Mm01_00194370 predicted 1363
3 SASI_Mm01_00194371 predicted 1066
4 SASI_Mm01_00194372 predicted 1287
5 SASI_Mm01_00194373 predicted 443
6 SASI_Mm01_00194374 predicted 761
7 SASI_Mm01_00194375 predicted 881
8 SASI_Mm01_00194376 predicted 1320
9 SASI_Mm02_00289286 predicted 852
10 SASI_Mm01_00194378 predicted 891
11 SASI_Mm01_00194377 predicted 1295
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009830 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073842 predicted 1067
2 SASI_Mm01_00073843 predicted 1272
3 SASI_Mm01_00073844 predicted 981
4 SASI_Mm01_00073845 predicted 1201
5 SASI_Mm01_00073846 predicted 356
6 SASI_Mm01_00073847 predicted 670
7 SASI_Mm01_00073848 predicted 788
8 SASI_Mm01_00073849 predicted 1234
9 SASI_Mm02_00317177 predicted 761
10 SASI_Mm01_00073851 predicted 801
11 SASI_Mm01_00073850 predicted 1203
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009830
VALIDATED
CCNE2 MISSION shRNA Bacterial Glycerol Stock
cyclin E2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009830.3-1176s21c1
Sequence:CCGGCCATGGAAGATAGACACAATACTCGAGTATTGTGTCTATCTTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009830.3-542s21c1
Sequence:CCGGCCACAGATGAGGTCAATACTTCTCGAGAAGTATTGACCTCATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009830.3-423s21c1
Sequence:CCGGCCTCACCTCTGCCAGATTTAACTCGAGTTAAATCTGGCAGAGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009830.3-191s21c1
Sequence:CCGGCCGCAAGAAACCCAGATAATTCTCGAGAATTATCTGGGTTTCTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009830.3-324s21c1
Sequence:CCGGTCAGCCCTTGCATTATCATTGCTCGAGCAATGATAATGCAAGGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009830.1-197s1c1
Sequence:CCGGGCCCTTGCATTATCATTGAAACTCGAGTTTCAATGATAATGCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009830.1-412s1c1
Sequence:CCGGCCACAGATGAGGTCAATACTTCTCGAGAAGTATTGACCTCATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009830.1-59s1c1
Sequence:CCGGCTCCGCAAGAAACCCAGATAACTCGAGTTATCTGGGTTTCTTGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009830.1-1046s1c1
Sequence:CCGGCCATGGAAGATAGACACAATACTCGAGTATTGTGTCTATCTTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009830.1-847s1c1
Sequence:CCGGCTAGCCATCGACTCTTTAGAACTCGAGTTCTAAAGAGTCGATGGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009830
VALIDATED
CCNE2 MISSION shRNA shRNA Plasmid DNA
cyclin E2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009830.3-1176s21c1
Sequence:CCGGCCATGGAAGATAGACACAATACTCGAGTATTGTGTCTATCTTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009830.3-542s21c1
Sequence:CCGGCCACAGATGAGGTCAATACTTCTCGAGAAGTATTGACCTCATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009830.3-423s21c1
Sequence:CCGGCCTCACCTCTGCCAGATTTAACTCGAGTTAAATCTGGCAGAGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009830.3-191s21c1
Sequence:CCGGCCGCAAGAAACCCAGATAATTCTCGAGAATTATCTGGGTTTCTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009830.3-324s21c1
Sequence:CCGGTCAGCCCTTGCATTATCATTGCTCGAGCAATGATAATGCAAGGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009830.1-197s1c1
Sequence:CCGGGCCCTTGCATTATCATTGAAACTCGAGTTTCAATGATAATGCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009830.1-412s1c1
Sequence:CCGGCCACAGATGAGGTCAATACTTCTCGAGAAGTATTGACCTCATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009830.1-59s1c1
Sequence:CCGGCTCCGCAAGAAACCCAGATAACTCGAGTTATCTGGGTTTCTTGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009830.1-1046s1c1
Sequence:CCGGCCATGGAAGATAGACACAATACTCGAGTATTGTGTCTATCTTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009830.1-847s1c1
Sequence:CCGGCTAGCCATCGACTCTTTAGAACTCGAGTTCTAAAGAGTCGATGGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009830
VALIDATED
CCNE2 MISSION shRNA Lentiviral Transduction Particles
cyclin E2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009830.3-1176s21c1
Sequence:CCGGCCATGGAAGATAGACACAATACTCGAGTATTGTGTCTATCTTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009830.3-542s21c1
Sequence:CCGGCCACAGATGAGGTCAATACTTCTCGAGAAGTATTGACCTCATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009830.3-423s21c1
Sequence:CCGGCCTCACCTCTGCCAGATTTAACTCGAGTTAAATCTGGCAGAGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009830.3-191s21c1
Sequence:CCGGCCGCAAGAAACCCAGATAATTCTCGAGAATTATCTGGGTTTCTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009830.3-324s21c1
Sequence:CCGGTCAGCCCTTGCATTATCATTGCTCGAGCAATGATAATGCAAGGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009830.1-197s1c1
Sequence:CCGGGCCCTTGCATTATCATTGAAACTCGAGTTTCAATGATAATGCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009830.1-412s1c1
Sequence:CCGGCCACAGATGAGGTCAATACTTCTCGAGAAGTATTGACCTCATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009830.1-59s1c1
Sequence:CCGGCTCCGCAAGAAACCCAGATAACTCGAGTTATCTGGGTTTCTTGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009830.1-1046s1c1
Sequence:CCGGCCATGGAAGATAGACACAATACTCGAGTATTGTGTCTATCTTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009830.1-847s1c1
Sequence:CCGGCTAGCCATCGACTCTTTAGAACTCGAGTTCTAAAGAGTCGATGGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004702
CCNE2 MISSION shRNA Bacterial Glycerol Stock
cyclin E2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004702.2-660s1c1
Sequence:CCGGGCTCTTAAAGATGCTCCTAAACTCGAGTTTAGGAGCATCTTTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004702.2-968s1c1
Sequence:CCGGCCAGACACATACAAACTATTTCTCGAGAAATAGTTTGTATGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004702.2-325s1c1
Sequence:CCGGCCATACTTCTAGACTGGCTTTCTCGAGAAAGCCAGTCTAGAAGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004702.2-735s1c1
Sequence:CCGGGATCTGTGTATTCTAGCCATTCTCGAGAATGGCTAGAATACACAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004702.2-507s1c1
Sequence:CCGGGCTCCTAAACTCCAAGAGTTTCTCGAGAAACTCTTGGAGTTTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004702
CCNE2 MISSION shRNA shRNA Plasmid DNA
cyclin E2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004702.2-660s1c1
Sequence:CCGGGCTCTTAAAGATGCTCCTAAACTCGAGTTTAGGAGCATCTTTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004702.2-968s1c1
Sequence:CCGGCCAGACACATACAAACTATTTCTCGAGAAATAGTTTGTATGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004702.2-325s1c1
Sequence:CCGGCCATACTTCTAGACTGGCTTTCTCGAGAAAGCCAGTCTAGAAGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004702.2-735s1c1
Sequence:CCGGGATCTGTGTATTCTAGCCATTCTCGAGAATGGCTAGAATACACAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004702.2-507s1c1
Sequence:CCGGGCTCCTAAACTCCAAGAGTTTCTCGAGAAACTCTTGGAGTTTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004702
CCNE2 MISSION shRNA Lentiviral Transduction Particles
cyclin E2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004702.2-660s1c1
Sequence:CCGGGCTCTTAAAGATGCTCCTAAACTCGAGTTTAGGAGCATCTTTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004702.2-968s1c1
Sequence:CCGGCCAGACACATACAAACTATTTCTCGAGAAATAGTTTGTATGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004702.2-325s1c1
Sequence:CCGGCCATACTTCTAGACTGGCTTTCTCGAGAAAGCCAGTCTAGAAGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004702.2-735s1c1
Sequence:CCGGGATCTGTGTATTCTAGCCATTCTCGAGAATGGCTAGAATACACAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004702.2-507s1c1
Sequence:CCGGGCTCCTAAACTCCAAGAGTTTCTCGAGAAACTCTTGGAGTTTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks