EMAIL THIS PAGE TO A FRIEND

CCNF

cyclin F

80 Gene Product Result for
Synonyms: FBX1 FBXO1
UniProtKB ID: P41002, B2R8H3, Q96EG9
Gene ID:
Human(899) Summary: This gene encodes a member of the cyclin family. Cyclins are important regulators of cell cycle transitions through their ability to bind and activate cyclin-dependent protein kinases. This member also belongs to the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and it was one of the first proteins in which the F-box motif was identified. [provided by RefSeq, Jul 2008]
Mouse(12449) cyclin F
Rat(117524) cyclin F
sheep(101116197) cyclin F
chicken(416749) cyclin F
cow(505200) cyclin F
dog(610890) cyclin F
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007634 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007634 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007634 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001761 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001761 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001761 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001761 Rosetta Predictions human pricing
NM_001100474 Rosetta Predictions rat pricing
NM_007634 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001761 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332487 predicted 520
2 SASI_Hs01_00031459 predicted 1634
3 SASI_Hs01_00031460 predicted 1531
4 SASI_Hs01_00031462 predicted 1253
5 SASI_Hs01_00031463 predicted 1162
6 SASI_Hs01_00031464 predicted 1685
7 SASI_Hs02_00332488 predicted 1923
8 SASI_Hs01_00031466 predicted 437
9 SASI_Hs01_00031467 predicted 2511
10 SASI_Hs02_00332489 predicted 1784
11 SASI_Hs01_00031461 predicted 955
12 SASI_Hs01_00031465 predicted 1509
13 SASI_Hs01_00031468 predicted 2341
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100474 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00209864 predicted 2174
2 SASI_Rn02_00209865 predicted 1169
3 SASI_Rn02_00209866 predicted 1126
4 SASI_Rn02_00209867 predicted 684
5 SASI_Rn02_00209868 predicted 282
6 SASI_Rn02_00209869 predicted 1067
7 SASI_Rn02_00209870 predicted 2222
8 SASI_Rn02_00209871 predicted 1571
9 SASI_Rn02_00209872 predicted 1744
10 SASI_Rn02_00209873 predicted 1487
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007634 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166491 predicted 616
2 SASI_Mm01_00166492 predicted 964
3 SASI_Mm01_00166493 predicted 1576
4 SASI_Mm02_00312109 predicted 203
5 SASI_Mm01_00166494 predicted 639
6 SASI_Mm01_00166495 predicted 741
7 SASI_Mm01_00166497 predicted 1161
8 SASI_Mm02_00312110 predicted 199
9 SASI_Mm01_00166498 predicted 1192
10 SASI_Mm01_00166499 predicted 1692
11 SASI_Mm01_00166496 predicted 441
12 SASI_Mm01_00166500 predicted 458
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007634
CCNF MISSION shRNA Bacterial Glycerol Stock
cyclin F
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007634.2-2925s1c1
Sequence:CCGGGCACTGAATTTCAAGGCCATTCTCGAGAATGGCCTTGAAATTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007634.2-90s1c1
Sequence:CCGGCCTACTAAACGAAGAATCAAACTCGAGTTTGATTCTTCGTTTAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007634.2-996s1c1
Sequence:CCGGGTTGCCACAATGAAGGACTTTCTCGAGAAAGTCCTTCATTGTGGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007634.2-1175s1c1
Sequence:CCGGGCTCACAGACAACACGTATAACTCGAGTTATACGTGTTGTCTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007634.2-1539s1c1
Sequence:CCGGGCACCCAAAGACTACAGACAACTCGAGTTGTCTGTAGTCTTTGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007634.4-664s21c1
Sequence:CCGGTGCTTGGGAAGGGTGCTAAATCTCGAGATTTAGCACCCTTCCCAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007634.4-1016s21c1
Sequence:CCGGGCGACACCATGAGGTACATTCCTCGAGGAATGTACCTCATGGTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007634.4-1236s21c1
Sequence:CCGGGCTCACAGACAACACGTATAACTCGAGTTATACGTGTTGTCTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007634.4-2986s21c1
Sequence:CCGGGCACTGAATTTCAAGGCCATTCTCGAGAATGGCCTTGAAATTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007634.4-1321s21c1
Sequence:CCGGCCTACCGTGGTTGACTATAAACTCGAGTTTATAGTCAACCACGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007634
CCNF MISSION shRNA shRNA Plasmid DNA
cyclin F
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007634.2-2925s1c1
Sequence:CCGGGCACTGAATTTCAAGGCCATTCTCGAGAATGGCCTTGAAATTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007634.2-90s1c1
Sequence:CCGGCCTACTAAACGAAGAATCAAACTCGAGTTTGATTCTTCGTTTAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007634.2-996s1c1
Sequence:CCGGGTTGCCACAATGAAGGACTTTCTCGAGAAAGTCCTTCATTGTGGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007634.2-1175s1c1
Sequence:CCGGGCTCACAGACAACACGTATAACTCGAGTTATACGTGTTGTCTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007634.2-1539s1c1
Sequence:CCGGGCACCCAAAGACTACAGACAACTCGAGTTGTCTGTAGTCTTTGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007634.4-664s21c1
Sequence:CCGGTGCTTGGGAAGGGTGCTAAATCTCGAGATTTAGCACCCTTCCCAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007634.4-1016s21c1
Sequence:CCGGGCGACACCATGAGGTACATTCCTCGAGGAATGTACCTCATGGTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007634.4-1236s21c1
Sequence:CCGGGCTCACAGACAACACGTATAACTCGAGTTATACGTGTTGTCTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007634.4-2986s21c1
Sequence:CCGGGCACTGAATTTCAAGGCCATTCTCGAGAATGGCCTTGAAATTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007634.4-1321s21c1
Sequence:CCGGCCTACCGTGGTTGACTATAAACTCGAGTTTATAGTCAACCACGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007634
CCNF MISSION shRNA Lentiviral Transduction Particles
cyclin F
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007634.2-2925s1c1
Sequence:CCGGGCACTGAATTTCAAGGCCATTCTCGAGAATGGCCTTGAAATTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007634.2-90s1c1
Sequence:CCGGCCTACTAAACGAAGAATCAAACTCGAGTTTGATTCTTCGTTTAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007634.2-996s1c1
Sequence:CCGGGTTGCCACAATGAAGGACTTTCTCGAGAAAGTCCTTCATTGTGGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007634.2-1175s1c1
Sequence:CCGGGCTCACAGACAACACGTATAACTCGAGTTATACGTGTTGTCTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007634.2-1539s1c1
Sequence:CCGGGCACCCAAAGACTACAGACAACTCGAGTTGTCTGTAGTCTTTGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007634.4-664s21c1
Sequence:CCGGTGCTTGGGAAGGGTGCTAAATCTCGAGATTTAGCACCCTTCCCAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007634.4-1016s21c1
Sequence:CCGGGCGACACCATGAGGTACATTCCTCGAGGAATGTACCTCATGGTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007634.4-1236s21c1
Sequence:CCGGGCTCACAGACAACACGTATAACTCGAGTTATACGTGTTGTCTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007634.4-2986s21c1
Sequence:CCGGGCACTGAATTTCAAGGCCATTCTCGAGAATGGCCTTGAAATTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007634.4-1321s21c1
Sequence:CCGGCCTACCGTGGTTGACTATAAACTCGAGTTTATAGTCAACCACGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001761
VALIDATED
CCNF MISSION shRNA Bacterial Glycerol Stock
cyclin F
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003831    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001761.x-3703s1c1
Sequence:CCGGCTCAACTCTCAACTCACTGTACTCGAGTACAGTGAGTTGAGAGTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001761.x-2329s1c1
Sequence:CCGGGCAACAGGTGAAGCGGATAAACTCGAGTTTATCCGCTTCACCTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001761.x-1180s1c1
Sequence:CCGGGCTCACGGACAACACTTACAACTCGAGTTGTAAGTGTTGTCCGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001761.x-2266s1c1
Sequence:CCGGTCAGGCCAGGAAGTCATGTTTCTCGAGAAACATGACTTCCTGGCCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001761.x-478s1c1
Sequence:CCGGCGCACCTTTCATCTGGCTCTTCTCGAGAAGAGCCAGATGAAAGGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001761.2-2374s21c1
Sequence:CCGGGCAACAGGTGAAGCGGATAAACTCGAGTTTATCCGCTTCACCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001761.2-1225s21c1
Sequence:CCGGGCTCACGGACAACACTTACAACTCGAGTTGTAAGTGTTGTCCGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001761.2-2311s21c1
Sequence:CCGGTCAGGCCAGGAAGTCATGTTTCTCGAGAAACATGACTTCCTGGCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279850    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_001761.2-3749s21c1
Sequence:CCGGCTCAACTCTCAACTCACTGTACTCGAGTACAGTGAGTTGAGAGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001761
VALIDATED
CCNF MISSION shRNA shRNA Plasmid DNA
cyclin F
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003831    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001761.x-3703s1c1
Sequence:CCGGCTCAACTCTCAACTCACTGTACTCGAGTACAGTGAGTTGAGAGTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001761.x-2329s1c1
Sequence:CCGGGCAACAGGTGAAGCGGATAAACTCGAGTTTATCCGCTTCACCTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001761.x-1180s1c1
Sequence:CCGGGCTCACGGACAACACTTACAACTCGAGTTGTAAGTGTTGTCCGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001761.x-2266s1c1
Sequence:CCGGTCAGGCCAGGAAGTCATGTTTCTCGAGAAACATGACTTCCTGGCCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001761.x-478s1c1
Sequence:CCGGCGCACCTTTCATCTGGCTCTTCTCGAGAAGAGCCAGATGAAAGGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001761.2-2374s21c1
Sequence:CCGGGCAACAGGTGAAGCGGATAAACTCGAGTTTATCCGCTTCACCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001761.2-1225s21c1
Sequence:CCGGGCTCACGGACAACACTTACAACTCGAGTTGTAAGTGTTGTCCGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001761.2-2311s21c1
Sequence:CCGGTCAGGCCAGGAAGTCATGTTTCTCGAGAAACATGACTTCCTGGCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279850    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_001761.2-3749s21c1
Sequence:CCGGCTCAACTCTCAACTCACTGTACTCGAGTACAGTGAGTTGAGAGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001761
VALIDATED
CCNF MISSION shRNA Lentiviral Transduction Particles
cyclin F
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003831    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001761.x-3703s1c1
Sequence:CCGGCTCAACTCTCAACTCACTGTACTCGAGTACAGTGAGTTGAGAGTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001761.x-2329s1c1
Sequence:CCGGGCAACAGGTGAAGCGGATAAACTCGAGTTTATCCGCTTCACCTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001761.x-1180s1c1
Sequence:CCGGGCTCACGGACAACACTTACAACTCGAGTTGTAAGTGTTGTCCGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001761.x-2266s1c1
Sequence:CCGGTCAGGCCAGGAAGTCATGTTTCTCGAGAAACATGACTTCCTGGCCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001761.x-478s1c1
Sequence:CCGGCGCACCTTTCATCTGGCTCTTCTCGAGAAGAGCCAGATGAAAGGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001761.2-2374s21c1
Sequence:CCGGGCAACAGGTGAAGCGGATAAACTCGAGTTTATCCGCTTCACCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001761.2-1225s21c1
Sequence:CCGGGCTCACGGACAACACTTACAACTCGAGTTGTAAGTGTTGTCCGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001761.2-2311s21c1
Sequence:CCGGTCAGGCCAGGAAGTCATGTTTCTCGAGAAACATGACTTCCTGGCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279850    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_001761.2-3749s21c1
Sequence:CCGGCTCAACTCTCAACTCACTGTACTCGAGTACAGTGAGTTGAGAGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks