EMAIL THIS PAGE TO A FRIEND

CCNG1

cyclin G1

133 Gene Product Result for
Synonyms: CCNG
UniProtKB ID: P51959, B2R7B2, D3DQK7, Q15757, Q96L32
Gene ID:
Human(900) Summary: The eukaryotic cell cycle is governed by cyclin-dependent protein kinases (CDKs) whose activities are regulated by cyclins and CDK inhibitors. The protein encoded by this gene is a member of the cyclin family and contains the cyclin box. The encoded protein lacks the protein destabilizing (PEST) sequence that is present in other family members. Transcriptional activation of this gene can be induced by tumor protein p53. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(12450) cyclin G1
Rat(25405) cyclin G1
sheep(101119213) cyclin G1
Zebrafish(171473) cyclin G1
chicken(416161) cyclin G1
cow(281671) cyclin G1
dog(479303) cyclin G1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004060 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004060 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004060 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009831 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009831 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009831 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004060 Rosetta Predictions human pricing
NM_199246 Rosetta Predictions human pricing
NM_012923 Rosetta Predictions rat pricing
NM_009831 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004060 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183300 predicted 795
2 SASI_Hs01_00183301 predicted 1117
3 SASI_Hs01_00183302 predicted 1063
4 SASI_Hs01_00183303 predicted 892
5 SASI_Hs01_00183304 predicted 1008
6 SASI_Hs02_00336842 predicted 698
7 SASI_Hs01_00183306 predicted 595
8 SASI_Hs02_00336843 predicted 423
9 SASI_Hs01_00183307 predicted 962
10 SASI_Hs01_00183308 predicted 1055
11 SASI_Hs01_00183305 predicted 431
12 SASI_Hs01_00183309 predicted 1169
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199246 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130541 predicted 696
2 SASI_Hs01_00130542 predicted 1017
3 SASI_Hs01_00130543 predicted 963
4 SASI_Hs01_00130544 predicted 792
5 SASI_Hs01_00130545 predicted 904
6 SASI_Hs02_00372686 predicted 594
7 SASI_Hs01_00130547 predicted 499
8 SASI_Hs02_00372687 predicted 320
9 SASI_Hs01_00130548 predicted 863
10 SASI_Hs01_00130549 predicted 953
11 SASI_Hs01_00130546 predicted 330
12 SASI_Hs01_00130550 predicted 1064
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012923 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070290 predicted 876
2 SASI_Rn02_00260466 predicted 905
3 SASI_Rn01_00070292 predicted 853
4 SASI_Rn01_00070293 predicted 926
5 SASI_Rn01_00070294 predicted 326
6 SASI_Rn01_00070295 predicted 593
7 SASI_Rn01_00070296 predicted 400
8 SASI_Rn01_00070297 predicted 1063
9 SASI_Rn01_00070298 predicted 992
10 SASI_Rn01_00070299 predicted 1130
11 SASI_Rn01_00070291 predicted 207
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009831 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112164 predicted 759
2 SASI_Mm01_00112165 predicted 1234
3 SASI_Mm01_00112167 predicted 414
4 SASI_Mm01_00112168 predicted 1230
5 SASI_Mm01_00112169 predicted 1227
6 SASI_Mm01_00112170 predicted 647
7 SASI_Mm01_00112171 predicted 657
8 SASI_Mm01_00112172 predicted 740
9 SASI_Mm01_00112173 predicted 553
10 SASI_Mm02_00317178 predicted 1100
11 SASI_Mm01_00112166 predicted 1015
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004060
VALIDATED
CCNG1 MISSION shRNA Bacterial Glycerol Stock
cyclin G1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004060.3-1012s21c1
Sequence:CCGGCCAAATGTTCAGAAGTTGAAACTCGAGTTTCAACTTCTGAACATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004060.3-472s21c1
Sequence:CCGGCTGGACAGATTCCTGTCTAAACTCGAGTTTAGACAGGAATCTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004060.3-784s21c1
Sequence:CCGGGCTCAACTGAAGGCATGTCATCTCGAGATGACATGCCTTCAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004060.3-353s21c1
Sequence:CCGGCACACGATAATGGCCTCAGAACTCGAGTTCTGAGGCCATTATCGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004060.3-844s21c1
Sequence:CCGGGCATTGTCTATCATTGCATTACTCGAGTAATGCAATGATAGACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004060.3-353s1c1
Sequence:CCGGCACACGATAATGGCCTCAGAACTCGAGTTCTGAGGCCATTATCGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004060.3-472s1c1
Sequence:CCGGCTGGACAGATTCCTGTCTAAACTCGAGTTTAGACAGGAATCTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004060.3-784s1c1
Sequence:CCGGGCTCAACTGAAGGCATGTCATCTCGAGATGACATGCCTTCAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004060.3-1012s1c1
Sequence:CCGGCCAAATGTTCAGAAGTTGAAACTCGAGTTTCAACTTCTGAACATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004060.3-844s1c1
Sequence:CCGGGCATTGTCTATCATTGCATTACTCGAGTAATGCAATGATAGACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004060
VALIDATED
CCNG1 MISSION shRNA shRNA Plasmid DNA
cyclin G1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004060.3-1012s21c1
Sequence:CCGGCCAAATGTTCAGAAGTTGAAACTCGAGTTTCAACTTCTGAACATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004060.3-472s21c1
Sequence:CCGGCTGGACAGATTCCTGTCTAAACTCGAGTTTAGACAGGAATCTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004060.3-784s21c1
Sequence:CCGGGCTCAACTGAAGGCATGTCATCTCGAGATGACATGCCTTCAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004060.3-353s21c1
Sequence:CCGGCACACGATAATGGCCTCAGAACTCGAGTTCTGAGGCCATTATCGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004060.3-844s21c1
Sequence:CCGGGCATTGTCTATCATTGCATTACTCGAGTAATGCAATGATAGACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004060.3-353s1c1
Sequence:CCGGCACACGATAATGGCCTCAGAACTCGAGTTCTGAGGCCATTATCGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004060.3-472s1c1
Sequence:CCGGCTGGACAGATTCCTGTCTAAACTCGAGTTTAGACAGGAATCTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004060.3-784s1c1
Sequence:CCGGGCTCAACTGAAGGCATGTCATCTCGAGATGACATGCCTTCAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004060.3-1012s1c1
Sequence:CCGGCCAAATGTTCAGAAGTTGAAACTCGAGTTTCAACTTCTGAACATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004060.3-844s1c1
Sequence:CCGGGCATTGTCTATCATTGCATTACTCGAGTAATGCAATGATAGACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004060
VALIDATED
CCNG1 MISSION shRNA Lentiviral Transduction Particles
cyclin G1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004060.3-1012s21c1
Sequence:CCGGCCAAATGTTCAGAAGTTGAAACTCGAGTTTCAACTTCTGAACATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004060.3-472s21c1
Sequence:CCGGCTGGACAGATTCCTGTCTAAACTCGAGTTTAGACAGGAATCTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004060.3-784s21c1
Sequence:CCGGGCTCAACTGAAGGCATGTCATCTCGAGATGACATGCCTTCAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004060.3-353s21c1
Sequence:CCGGCACACGATAATGGCCTCAGAACTCGAGTTCTGAGGCCATTATCGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004060.3-844s21c1
Sequence:CCGGGCATTGTCTATCATTGCATTACTCGAGTAATGCAATGATAGACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004060.3-353s1c1
Sequence:CCGGCACACGATAATGGCCTCAGAACTCGAGTTCTGAGGCCATTATCGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004060.3-472s1c1
Sequence:CCGGCTGGACAGATTCCTGTCTAAACTCGAGTTTAGACAGGAATCTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004060.3-784s1c1
Sequence:CCGGGCTCAACTGAAGGCATGTCATCTCGAGATGACATGCCTTCAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004060.3-1012s1c1
Sequence:CCGGCCAAATGTTCAGAAGTTGAAACTCGAGTTTCAACTTCTGAACATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004060.3-844s1c1
Sequence:CCGGGCATTGTCTATCATTGCATTACTCGAGTAATGCAATGATAGACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009831
VALIDATED
CCNG1 MISSION shRNA Bacterial Glycerol Stock
cyclin G1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000302103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009831.2-402s21c1
Sequence:CCGGCCCATGATAATGGCCTCAGAACTCGAGTTCTGAGGCCATTATCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009831.2-975s21c1
Sequence:CCGGCCAAGATAAGTGGCCGAGATTCTCGAGAATCTCGGCCACTTATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009831.2-635s21c1
Sequence:CCGGGCGACTGATTTGATCCGAATACTCGAGTATTCGGATCAAATCAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009831.2-1061s21c1
Sequence:CCGGCCTAACGGTCAGAAGTTGAAACTCGAGTTTCAACTTCTGACCGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009831.1-918s1c1
Sequence:CCGGCCAAGATAAGTGGCCGAGATTCTCGAGAATCTCGGCCACTTATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009831.1-1004s1c1
Sequence:CCGGCCTAACGGTCAGAAGTTGAAACTCGAGTTTCAACTTCTGACCGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009831.1-578s1c1
Sequence:CCGGGCGACTGATTTGATCCGAATACTCGAGTATTCGGATCAAATCAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009831.1-345s1c1
Sequence:CCGGCCCATGATAATGGCCTCAGAACTCGAGTTCTGAGGCCATTATCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009831.1-866s1c1
Sequence:CCGGGCACTGAAATACGTAGAGTTACTCGAGTAACTCTACGTATTTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009831
VALIDATED
CCNG1 MISSION shRNA shRNA Plasmid DNA
cyclin G1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000302103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009831.2-402s21c1
Sequence:CCGGCCCATGATAATGGCCTCAGAACTCGAGTTCTGAGGCCATTATCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009831.2-975s21c1
Sequence:CCGGCCAAGATAAGTGGCCGAGATTCTCGAGAATCTCGGCCACTTATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009831.2-635s21c1
Sequence:CCGGGCGACTGATTTGATCCGAATACTCGAGTATTCGGATCAAATCAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009831.2-1061s21c1
Sequence:CCGGCCTAACGGTCAGAAGTTGAAACTCGAGTTTCAACTTCTGACCGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009831.1-918s1c1
Sequence:CCGGCCAAGATAAGTGGCCGAGATTCTCGAGAATCTCGGCCACTTATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009831.1-1004s1c1
Sequence:CCGGCCTAACGGTCAGAAGTTGAAACTCGAGTTTCAACTTCTGACCGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009831.1-578s1c1
Sequence:CCGGGCGACTGATTTGATCCGAATACTCGAGTATTCGGATCAAATCAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009831.1-345s1c1
Sequence:CCGGCCCATGATAATGGCCTCAGAACTCGAGTTCTGAGGCCATTATCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009831.1-866s1c1
Sequence:CCGGGCACTGAAATACGTAGAGTTACTCGAGTAACTCTACGTATTTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009831
VALIDATED
CCNG1 MISSION shRNA Lentiviral Transduction Particles
cyclin G1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000302103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009831.2-402s21c1
Sequence:CCGGCCCATGATAATGGCCTCAGAACTCGAGTTCTGAGGCCATTATCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009831.2-975s21c1
Sequence:CCGGCCAAGATAAGTGGCCGAGATTCTCGAGAATCTCGGCCACTTATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009831.2-635s21c1
Sequence:CCGGGCGACTGATTTGATCCGAATACTCGAGTATTCGGATCAAATCAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009831.2-1061s21c1
Sequence:CCGGCCTAACGGTCAGAAGTTGAAACTCGAGTTTCAACTTCTGACCGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009831.1-918s1c1
Sequence:CCGGCCAAGATAAGTGGCCGAGATTCTCGAGAATCTCGGCCACTTATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009831.1-1004s1c1
Sequence:CCGGCCTAACGGTCAGAAGTTGAAACTCGAGTTTCAACTTCTGACCGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009831.1-578s1c1
Sequence:CCGGGCGACTGATTTGATCCGAATACTCGAGTATTCGGATCAAATCAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009831.1-345s1c1
Sequence:CCGGCCCATGATAATGGCCTCAGAACTCGAGTTCTGAGGCCATTATCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009831.1-866s1c1
Sequence:CCGGGCACTGAAATACGTAGAGTTACTCGAGTAACTCTACGTATTTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks