EMAIL THIS PAGE TO A FRIEND

CCNG2

cyclin G2

UniProtKB ID: Q16589
Gene ID:
Human(901) Summary: The eukaryotic cell cycle is governed by cyclin-dependent protein kinases (CDKs) whose activities are regulated by cyclins and CDK inhibitors. The 8 species of cyclins reported in mammals, cyclins A through H, share a conserved amino acid sequence of about 90 residues called the cyclin box. The amino acid sequence of cyclin G is well conserved among mammals. The nucleotide sequence of cyclin G1 and cyclin G2 are 53% identical. Unlike cyclin G1, cyclin G2 contains a C-terminal PEST protein destabilization motif, suggesting that cyclin G2 expression is tightly regulated through the cell cycle. [provided by RefSeq, Jul 2008]
Mouse(12452) cyclin G2
Rat(29157) cyclin G2
Zebrafish(266794) cyclin G2
cow(512960) cyclin G2
dog(478442) cyclin G2
chicken(422512) cyclin G2
sheep(101110594) cyclin G2
162 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007635 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007635 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007635 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004354 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004354 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004354 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004354 Rosetta Predictions human pricing
NM_001105725 Rosetta Predictions rat pricing
NM_007635 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004354 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168152 predicted 1317
2 SASI_Hs01_00168155 predicted 1057
3 SASI_Hs01_00168156 predicted 388
4 SASI_Hs01_00168157 predicted 1418
5 SASI_Hs01_00168158 predicted 583
6 SASI_Hs01_00168159 predicted 1212
7 SASI_Hs02_00337417 predicted 1352
8 SASI_Hs01_00168161 predicted 477
9 SASI_Hs02_00337418 predicted 684
10 SASI_Hs02_00337419 predicted 1216
11 SASI_Hs01_00168153 predicted 527
12 SASI_Hs01_00168154 predicted 628
13 SASI_Hs01_00168160 predicted 408
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105725 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211916 predicted 924
2 SASI_Rn02_00211917 predicted 307
3 SASI_Rn02_00211918 predicted 265
4 SASI_Rn02_00211919 predicted 670
5 SASI_Rn02_00211920 predicted 975
6 SASI_Rn02_00211921 predicted 805
7 SASI_Rn02_00211922 predicted 847
8 SASI_Rn02_00211923 predicted 364
9 SASI_Rn02_00211924 predicted 1208
10 SASI_Rn02_00211925 predicted 569
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007635 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054926 predicted 563
2 SASI_Mm01_00054927 predicted 1251
3 SASI_Mm01_00054928 predicted 813
4 SASI_Mm01_00054929 predicted 308
5 SASI_Mm02_00312111 predicted 965
6 SASI_Mm01_00054930 predicted 1259
7 SASI_Mm02_00312112 predicted 1064
8 SASI_Mm01_00054931 predicted 711
9 SASI_Mm01_00054932 predicted 477
10 SASI_Mm01_00054933 predicted 681
11 SASI_Mm01_00054934 predicted 725
12 SASI_Mm01_00054935 predicted 1339
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007635
CCNG2 MISSION shRNA Bacterial Glycerol Stock
cyclin G2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007635.2-2448s1c1
Sequence:CCGGCCAGTGTTTGTAGTGTTAGTTCTCGAGAACTAACACTACAAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007635.2-1289s1c1
Sequence:CCGGCTAAATGTCTAGCAGAGTATTCTCGAGAATACTCTGCTAGACATTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007635.2-951s1c1
Sequence:CCGGTGACATTAAACGCATGGAGAACTCGAGTTCTCCATGCGTTTAATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007635.2-1340s1c1
Sequence:CCGGAGAAGCTGGTATGGATTGTTTCTCGAGAAACAATCCATACCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007635.2-1139s1c1
Sequence:CCGGCCAAAGCAAGACCATCTGTATCTCGAGATACAGATGGTCTTGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007635.4-1285s21c1
Sequence:CCGGTAAAGTGTGTGTACCTATTTCCTCGAGGAAATAGGTACACACACTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007635.4-714s21c1
Sequence:CCGGCTTGTACCACGCGATTGTATTCTCGAGAATACAATCGCGTGGTACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007635.4-601s21c1
Sequence:CCGGATCCGCATCAGTCAGTGTAAACTCGAGTTTACACTGACTGATGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007635.4-757s21c1
Sequence:CCGGGAGATTCTCAGCCTCGATAAACTCGAGTTTATCGAGGCTGAGAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007635.4-454s21c1
Sequence:CCGGTTCGTTCTGGCTGTCAATATTCTCGAGAATATTGACAGCCAGAACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007635
CCNG2 MISSION shRNA shRNA Plasmid DNA
cyclin G2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007635.2-2448s1c1
Sequence:CCGGCCAGTGTTTGTAGTGTTAGTTCTCGAGAACTAACACTACAAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007635.2-1289s1c1
Sequence:CCGGCTAAATGTCTAGCAGAGTATTCTCGAGAATACTCTGCTAGACATTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007635.2-951s1c1
Sequence:CCGGTGACATTAAACGCATGGAGAACTCGAGTTCTCCATGCGTTTAATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007635.2-1340s1c1
Sequence:CCGGAGAAGCTGGTATGGATTGTTTCTCGAGAAACAATCCATACCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007635.2-1139s1c1
Sequence:CCGGCCAAAGCAAGACCATCTGTATCTCGAGATACAGATGGTCTTGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007635.4-1285s21c1
Sequence:CCGGTAAAGTGTGTGTACCTATTTCCTCGAGGAAATAGGTACACACACTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007635.4-714s21c1
Sequence:CCGGCTTGTACCACGCGATTGTATTCTCGAGAATACAATCGCGTGGTACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007635.4-601s21c1
Sequence:CCGGATCCGCATCAGTCAGTGTAAACTCGAGTTTACACTGACTGATGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007635.4-757s21c1
Sequence:CCGGGAGATTCTCAGCCTCGATAAACTCGAGTTTATCGAGGCTGAGAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007635.4-454s21c1
Sequence:CCGGTTCGTTCTGGCTGTCAATATTCTCGAGAATATTGACAGCCAGAACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007635
CCNG2 MISSION shRNA Lentiviral Transduction Particles
cyclin G2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007635.2-2448s1c1
Sequence:CCGGCCAGTGTTTGTAGTGTTAGTTCTCGAGAACTAACACTACAAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007635.2-1289s1c1
Sequence:CCGGCTAAATGTCTAGCAGAGTATTCTCGAGAATACTCTGCTAGACATTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007635.2-951s1c1
Sequence:CCGGTGACATTAAACGCATGGAGAACTCGAGTTCTCCATGCGTTTAATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007635.2-1340s1c1
Sequence:CCGGAGAAGCTGGTATGGATTGTTTCTCGAGAAACAATCCATACCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007635.2-1139s1c1
Sequence:CCGGCCAAAGCAAGACCATCTGTATCTCGAGATACAGATGGTCTTGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007635.4-1285s21c1
Sequence:CCGGTAAAGTGTGTGTACCTATTTCCTCGAGGAAATAGGTACACACACTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007635.4-714s21c1
Sequence:CCGGCTTGTACCACGCGATTGTATTCTCGAGAATACAATCGCGTGGTACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007635.4-601s21c1
Sequence:CCGGATCCGCATCAGTCAGTGTAAACTCGAGTTTACACTGACTGATGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007635.4-757s21c1
Sequence:CCGGGAGATTCTCAGCCTCGATAAACTCGAGTTTATCGAGGCTGAGAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007635.4-454s21c1
Sequence:CCGGTTCGTTCTGGCTGTCAATATTCTCGAGAATATTGACAGCCAGAACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004354
CCNG2 MISSION shRNA Bacterial Glycerol Stock
cyclin G2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004354.1-892s1c1
Sequence:CCGGGCCGAGTATTCTTCTCCTGAACTCGAGTTCAGGAGAAGAATACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004354.1-922s1c1
Sequence:CCGGCCAGATCTTAAGAAGTTGGTTCTCGAGAACCAACTTCTTAAGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004354.1-778s1c1
Sequence:CCGGGTGGAAACTTTGAAATCTGTTCTCGAGAACAGATTTCAAAGTTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004354.1-267s1c1
Sequence:CCGGCCCGGAGAATGATAACACTTTCTCGAGAAAGTGTTATCATTCTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004354.1-460s1c1
Sequence:CCGGGCTGCTAGAATAGTTGAAGAACTCGAGTTCTTCAACTATTCTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004354
CCNG2 MISSION shRNA shRNA Plasmid DNA
cyclin G2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004354.1-892s1c1
Sequence:CCGGGCCGAGTATTCTTCTCCTGAACTCGAGTTCAGGAGAAGAATACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004354.1-922s1c1
Sequence:CCGGCCAGATCTTAAGAAGTTGGTTCTCGAGAACCAACTTCTTAAGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004354.1-778s1c1
Sequence:CCGGGTGGAAACTTTGAAATCTGTTCTCGAGAACAGATTTCAAAGTTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004354.1-267s1c1
Sequence:CCGGCCCGGAGAATGATAACACTTTCTCGAGAAAGTGTTATCATTCTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004354.1-460s1c1
Sequence:CCGGGCTGCTAGAATAGTTGAAGAACTCGAGTTCTTCAACTATTCTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004354
CCNG2 MISSION shRNA Lentiviral Transduction Particles
cyclin G2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004354.1-892s1c1
Sequence:CCGGGCCGAGTATTCTTCTCCTGAACTCGAGTTCAGGAGAAGAATACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004354.1-922s1c1
Sequence:CCGGCCAGATCTTAAGAAGTTGGTTCTCGAGAACCAACTTCTTAAGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004354.1-778s1c1
Sequence:CCGGGTGGAAACTTTGAAATCTGTTCTCGAGAACAGATTTCAAAGTTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004354.1-267s1c1
Sequence:CCGGCCCGGAGAATGATAACACTTTCTCGAGAAAGTGTTATCATTCTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004354.1-460s1c1
Sequence:CCGGGCTGCTAGAATAGTTGAAGAACTCGAGTTCTTCAACTATTCTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks