EMAIL THIS PAGE TO A FRIEND

CCNH

cyclin H

70 Gene Product Result for
Synonyms: CAK p34 p37
UniProtKB ID: P51946, Q53X72, Q8TBL9
Gene ID:
Human(902) Summary: The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with CDK7 kinase and ring finger protein MAT1. The kinase complex is able to phosphorylate CDK2 and CDC2 kinases, thus functions as a CDK-activating kinase (CAK). This cyclin and its kinase partner are components of TFIIH, as well as RNA polymerase II protein complexes. They participate in two different transcriptional regulation processes, suggesting an important link between basal transcription control and the cell cycle machinery. A pseudogene of this gene is found on chromosome 4. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Nov 2010]
Mouse(66671) cyclin H
Rat(84389) cyclin H
sheep(101104905) cyclin H
cow(615512) cyclin H
Horse(100065185) cyclin H
dog(479156) cyclin H
chicken(427328) cyclin H
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001239 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001239 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001239 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023243 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023243 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023243 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001239 Rosetta Predictions human pricing
NM_052981 Rosetta Predictions rat pricing
NM_023243 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001239 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206144 predicted 683
2 SASI_Hs01_00206145 predicted 1088
3 SASI_Hs01_00206146 predicted 660
4 SASI_Hs01_00206147 predicted 703
5 SASI_Hs01_00206148 predicted 910
6 SASI_Hs01_00206149 predicted 648
7 SASI_Hs01_00206151 predicted 953
8 SASI_Hs01_00206152 predicted 971
9 SASI_Hs01_00206153 predicted 652
10 SASI_Hs02_00331411 predicted 767
11 SASI_Hs01_00206150 predicted 901
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052981 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096229 predicted 1145
2 SASI_Rn01_00096230 predicted 459
3 SASI_Rn01_00096232 predicted 590
4 SASI_Rn01_00096233 predicted 606
5 SASI_Rn01_00096234 predicted 528
6 SASI_Rn01_00096235 predicted 988
7 SASI_Rn01_00096236 predicted 1090
8 SASI_Rn01_00096237 predicted 767
9 SASI_Rn01_00096238 predicted 734
10 SASI_Rn02_00265625 predicted 745
11 SASI_Rn01_00096231 predicted 782
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023243 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326995 predicted 787
2 SASI_Mm01_00129178 predicted 340
3 SASI_Mm01_00129179 predicted 354
4 SASI_Mm02_00326996 predicted 523
5 SASI_Mm01_00129180 predicted 1010
6 SASI_Mm02_00326997 predicted 779
7 SASI_Mm01_00129181 predicted 914
8 SASI_Mm02_00326998 predicted 289
9 SASI_Mm01_00129182 predicted 1001
10 SASI_Mm01_00129183 predicted 536
11 SASI_Mm01_00129184 predicted 695
12 SASI_Mm01_00129185 predicted 1003
13 SASI_Mm01_00129186 predicted 1013
14 SASI_Mm01_00129187 predicted 1030
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001239
CCNH MISSION shRNA Bacterial Glycerol Stock
cyclin H
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001239.2-353s21c1
Sequence:CCGGCTTCCGAATGATCCAGTCTTTCTCGAGAAAGACTGGATCATTCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001239.2-688s21c1
Sequence:CCGGGCAACTTAATTTCCACCTTATCTCGAGATAAGGTGGAAATTAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001239.2-1183s21c1
Sequence:CCGGCGACCTGGTAGAATCTCTCTACTCGAGTAGAGAGATTCTACCAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001239.2-534s21c1
Sequence:CCGGCCAGGATAATAATGCTCACTTCTCGAGAAGTGAGCATTATTATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001239.2-761s1c1
Sequence:CCGGCGCTATCCCATATTGGAGAATCTCGAGATTCTCCAATATGGGATAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001239.2-1183s1c1
Sequence:CCGGCGACCTGGTAGAATCTCTCTACTCGAGTAGAGAGATTCTACCAGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001239.2-534s1c1
Sequence:CCGGCCAGGATAATAATGCTCACTTCTCGAGAAGTGAGCATTATTATCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001239.2-688s1c1
Sequence:CCGGGCAACTTAATTTCCACCTTATCTCGAGATAAGGTGGAAATTAAGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001239.2-353s1c1
Sequence:CCGGCTTCCGAATGATCCAGTCTTTCTCGAGAAAGACTGGATCATTCGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001239
CCNH MISSION shRNA shRNA Plasmid DNA
cyclin H
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001239.2-353s21c1
Sequence:CCGGCTTCCGAATGATCCAGTCTTTCTCGAGAAAGACTGGATCATTCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001239.2-688s21c1
Sequence:CCGGGCAACTTAATTTCCACCTTATCTCGAGATAAGGTGGAAATTAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001239.2-1183s21c1
Sequence:CCGGCGACCTGGTAGAATCTCTCTACTCGAGTAGAGAGATTCTACCAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001239.2-534s21c1
Sequence:CCGGCCAGGATAATAATGCTCACTTCTCGAGAAGTGAGCATTATTATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001239.2-761s1c1
Sequence:CCGGCGCTATCCCATATTGGAGAATCTCGAGATTCTCCAATATGGGATAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001239.2-1183s1c1
Sequence:CCGGCGACCTGGTAGAATCTCTCTACTCGAGTAGAGAGATTCTACCAGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001239.2-534s1c1
Sequence:CCGGCCAGGATAATAATGCTCACTTCTCGAGAAGTGAGCATTATTATCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001239.2-688s1c1
Sequence:CCGGGCAACTTAATTTCCACCTTATCTCGAGATAAGGTGGAAATTAAGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001239.2-353s1c1
Sequence:CCGGCTTCCGAATGATCCAGTCTTTCTCGAGAAAGACTGGATCATTCGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001239
CCNH MISSION shRNA Lentiviral Transduction Particles
cyclin H
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001239.2-353s21c1
Sequence:CCGGCTTCCGAATGATCCAGTCTTTCTCGAGAAAGACTGGATCATTCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001239.2-688s21c1
Sequence:CCGGGCAACTTAATTTCCACCTTATCTCGAGATAAGGTGGAAATTAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001239.2-1183s21c1
Sequence:CCGGCGACCTGGTAGAATCTCTCTACTCGAGTAGAGAGATTCTACCAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001239.2-534s21c1
Sequence:CCGGCCAGGATAATAATGCTCACTTCTCGAGAAGTGAGCATTATTATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001239.2-761s1c1
Sequence:CCGGCGCTATCCCATATTGGAGAATCTCGAGATTCTCCAATATGGGATAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001239.2-1183s1c1
Sequence:CCGGCGACCTGGTAGAATCTCTCTACTCGAGTAGAGAGATTCTACCAGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001239.2-534s1c1
Sequence:CCGGCCAGGATAATAATGCTCACTTCTCGAGAAGTGAGCATTATTATCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001239.2-688s1c1
Sequence:CCGGGCAACTTAATTTCCACCTTATCTCGAGATAAGGTGGAAATTAAGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001239.2-353s1c1
Sequence:CCGGCTTCCGAATGATCCAGTCTTTCTCGAGAAAGACTGGATCATTCGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023243
VALIDATED
CCNH MISSION shRNA Bacterial Glycerol Stock
cyclin H
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000222747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023243.2-792s1c2
Sequence:CCGGCCTGTCACAGTTACTGGATATCTCGAGATATCCAGTAACTGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023243.5-539s21c1
Sequence:CCGGCCACAATCCATACAGACCATTCTCGAGAATGGTCTGTATGGATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023243.5-655s21c1
Sequence:CCGGCATTGACAGATGCTTATCTTTCTCGAGAAAGATAAGCATCTGTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023243.5-748s21c1
Sequence:CCGGGCTACTTATCAGAGAGTCTAACTCGAGTTAGACTCTCTGATAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023243.5-351s21c1
Sequence:CCGGGAATATCACCCTCGGATAATACTCGAGTATTATCCGAGGGTGATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311058    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023243.5-1042s21c1
Sequence:CCGGTGACCGCAGCAGTACTTATTACTCGAGTAATAAGTACTGCTGCGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023243.2-1337s1c1
Sequence:CCGGCCTTTCCATTTAGAAGCATTACTCGAGTAATGCTTCTAAATGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023243.2-749s1c1
Sequence:CCGGGCTACTTATCAGAGAGTCTAACTCGAGTTAGACTCTCTGATAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023243.2-540s1c1
Sequence:CCGGCCACAATCCATACAGACCATTCTCGAGAATGGTCTGTATGGATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023243.2-656s1c1
Sequence:CCGGCATTGACAGATGCTTATCTTTCTCGAGAAAGATAAGCATCTGTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023243
VALIDATED
CCNH MISSION shRNA shRNA Plasmid DNA
cyclin H
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000222747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023243.2-792s1c2
Sequence:CCGGCCTGTCACAGTTACTGGATATCTCGAGATATCCAGTAACTGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023243.5-539s21c1
Sequence:CCGGCCACAATCCATACAGACCATTCTCGAGAATGGTCTGTATGGATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023243.5-655s21c1
Sequence:CCGGCATTGACAGATGCTTATCTTTCTCGAGAAAGATAAGCATCTGTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023243.5-748s21c1
Sequence:CCGGGCTACTTATCAGAGAGTCTAACTCGAGTTAGACTCTCTGATAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023243.5-351s21c1
Sequence:CCGGGAATATCACCCTCGGATAATACTCGAGTATTATCCGAGGGTGATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311058    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023243.5-1042s21c1
Sequence:CCGGTGACCGCAGCAGTACTTATTACTCGAGTAATAAGTACTGCTGCGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023243.2-1337s1c1
Sequence:CCGGCCTTTCCATTTAGAAGCATTACTCGAGTAATGCTTCTAAATGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023243.2-749s1c1
Sequence:CCGGGCTACTTATCAGAGAGTCTAACTCGAGTTAGACTCTCTGATAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023243.2-540s1c1
Sequence:CCGGCCACAATCCATACAGACCATTCTCGAGAATGGTCTGTATGGATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023243.2-656s1c1
Sequence:CCGGCATTGACAGATGCTTATCTTTCTCGAGAAAGATAAGCATCTGTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023243
VALIDATED
CCNH MISSION shRNA Lentiviral Transduction Particles
cyclin H
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000222747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023243.2-792s1c2
Sequence:CCGGCCTGTCACAGTTACTGGATATCTCGAGATATCCAGTAACTGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023243.5-539s21c1
Sequence:CCGGCCACAATCCATACAGACCATTCTCGAGAATGGTCTGTATGGATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023243.5-655s21c1
Sequence:CCGGCATTGACAGATGCTTATCTTTCTCGAGAAAGATAAGCATCTGTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023243.5-748s21c1
Sequence:CCGGGCTACTTATCAGAGAGTCTAACTCGAGTTAGACTCTCTGATAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023243.5-351s21c1
Sequence:CCGGGAATATCACCCTCGGATAATACTCGAGTATTATCCGAGGGTGATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311058    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023243.5-1042s21c1
Sequence:CCGGTGACCGCAGCAGTACTTATTACTCGAGTAATAAGTACTGCTGCGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023243.2-1337s1c1
Sequence:CCGGCCTTTCCATTTAGAAGCATTACTCGAGTAATGCTTCTAAATGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023243.2-749s1c1
Sequence:CCGGGCTACTTATCAGAGAGTCTAACTCGAGTTAGACTCTCTGATAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023243.2-540s1c1
Sequence:CCGGCCACAATCCATACAGACCATTCTCGAGAATGGTCTGTATGGATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023243.2-656s1c1
Sequence:CCGGCATTGACAGATGCTTATCTTTCTCGAGAAAGATAAGCATCTGTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks