EMAIL THIS PAGE TO A FRIEND

CCNI2

cyclin I family, member 2

19 Gene Product Result for
UniProtKB ID: Q6ZMN8, B2RNE2
Gene ID:
domestic guinea pig(101788802) cyclin I family, member 2
Zebrafish(100330479) cyclin I family, member 2
chicken(771567) cyclin I family, member 2
cow(618330) cyclin I family, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039780 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039780 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039780 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU103711 MISSION® esiRNA esiRNA human CCNI2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039780 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039780 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308672 predicted 769
2 SASI_Hs01_00030732 predicted 1604
3 SASI_Hs01_00030733 predicted 1012
4 SASI_Hs01_00030734 predicted 591
5 SASI_Hs01_00030735 predicted 632
6 SASI_Hs01_00030736 predicted 479
7 SASI_Hs01_00030737 predicted 802
8 SASI_Hs01_00030738 predicted 1045
9 SASI_Hs01_00030740 predicted 1074
10 SASI_Hs01_00030741 predicted 705
11 SASI_Hs01_00030739 predicted 1027
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039780
CCNI2 MISSION shRNA Bacterial Glycerol Stock
cyclin I family, member 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039780.2-622s21c1
Sequence:CCGGTACCTGCATTGCGCCACAATTCTCGAGAATTGTGGCGCAATGCAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039780.2-808s21c1
Sequence:CCGGCTGGACTTCTTGACTATATTCCTCGAGGAATATAGTCAAGAAGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039780.2-1026s21c1
Sequence:CCGGTCCTATATCTGATCTGCTAAACTCGAGTTTAGCAGATCAGATATAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039780.2-1859s21c1
Sequence:CCGGGTGCTAATGAATGGGTATTATCTCGAGATAATACCCATTCATTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039780.2-1077s21c1
Sequence:CCGGCTGCTGCAAGGAACTTGTAATCTCGAGATTACAAGTTCCTTGCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039780
CCNI2 MISSION shRNA shRNA Plasmid DNA
cyclin I family, member 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039780.2-622s21c1
Sequence:CCGGTACCTGCATTGCGCCACAATTCTCGAGAATTGTGGCGCAATGCAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039780.2-808s21c1
Sequence:CCGGCTGGACTTCTTGACTATATTCCTCGAGGAATATAGTCAAGAAGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039780.2-1026s21c1
Sequence:CCGGTCCTATATCTGATCTGCTAAACTCGAGTTTAGCAGATCAGATATAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039780.2-1859s21c1
Sequence:CCGGGTGCTAATGAATGGGTATTATCTCGAGATAATACCCATTCATTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039780.2-1077s21c1
Sequence:CCGGCTGCTGCAAGGAACTTGTAATCTCGAGATTACAAGTTCCTTGCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039780
CCNI2 MISSION shRNA Lentiviral Transduction Particles
cyclin I family, member 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039780.2-622s21c1
Sequence:CCGGTACCTGCATTGCGCCACAATTCTCGAGAATTGTGGCGCAATGCAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039780.2-808s21c1
Sequence:CCGGCTGGACTTCTTGACTATATTCCTCGAGGAATATAGTCAAGAAGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039780.2-1026s21c1
Sequence:CCGGTCCTATATCTGATCTGCTAAACTCGAGTTTAGCAGATCAGATATAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039780.2-1859s21c1
Sequence:CCGGGTGCTAATGAATGGGTATTATCTCGAGATAATACCCATTCATTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039780.2-1077s21c1
Sequence:CCGGCTGCTGCAAGGAACTTGTAATCTCGAGATTACAAGTTCCTTGCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks