EMAIL THIS PAGE TO A FRIEND

CCNJ

cyclin J

212 Gene Product Result for
Synonyms: bA690P14.1
UniProtKB ID: Q5T5M9, B7Z4E7, Q86XL1, Q9NV69
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019084 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019084 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019084 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172839 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172839 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172839 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU138111 MISSION® esiRNA esiRNA human CCNJ (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019084 Rosetta Predictions human pricing
NM_001106369 Rosetta Predictions rat pricing
NM_172839 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019084 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194833 predicted 1029
2 SASI_Hs01_00194834 predicted 745
3 SASI_Hs02_00352683 predicted 1057
4 SASI_Hs01_00194835 predicted 1379
5 SASI_Hs01_00194836 predicted 555
6 SASI_Hs01_00194838 predicted 1522
7 SASI_Hs02_00352684 predicted 965
8 SASI_Hs01_00194839 predicted 1250
9 SASI_Hs01_00194840 predicted 1137
10 SASI_Hs01_00194842 predicted 586
11 SASI_Hs01_00194837 predicted 932
12 SASI_Hs01_00194841 predicted 1465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106369 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218288 predicted 645
2 SASI_Rn02_00218289 predicted 308
3 SASI_Rn02_00218290 predicted 776
4 SASI_Rn02_00218291 predicted 766
5 SASI_Rn02_00218292 predicted 1327
6 SASI_Rn02_00218293 predicted 1125
7 SASI_Rn02_00218294 predicted 756
8 SASI_Rn02_00218295 predicted 1282
9 SASI_Rn02_00218296 predicted 1239
10 SASI_Rn02_00218297 predicted 739
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172839 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104489 predicted 1285
2 SASI_Mm01_00104490 predicted 421
3 SASI_Mm02_00344770 predicted 431
4 SASI_Mm01_00104491 predicted 1304
5 SASI_Mm01_00104492 predicted 778
6 SASI_Mm01_00104493 predicted 766
7 SASI_Mm02_00344771 predicted 446
8 SASI_Mm01_00104494 predicted 783
9 SASI_Mm01_00104496 predicted 1127
10 SASI_Mm01_00104498 predicted 521
11 SASI_Mm01_00104495 predicted 1368
12 SASI_Mm01_00104497 predicted 1298
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019084
VALIDATED
CCNJ MISSION shRNA Bacterial Glycerol Stock
cyclin J
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000288843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019084.4-1422s21c1
Sequence:CCGGCGGAGTTATCAGATAAATGAACTCGAGTTCATTTATCTGATAACTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019084.4-1448s21c1
Sequence:CCGGCCCTTGTATTACTCCATGTTTCTCGAGAAACATGGAGTAATACAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019084.4-964s21c1
Sequence:CCGGCGAGGATTATACTTCGTCTTTCTCGAGAAAGACGAAGTATAATCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019084.4-692s21c1
Sequence:CCGGCCTGGGTTGTATGACTAATATCTCGAGATATTAGTCATACAACCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_019084.2-1458s1c1
Sequence:CCGGCCCTTGTATTACTCCATGTTTCTCGAGAAACATGGAGTAATACAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_019084.2-810s1c1
Sequence:CCGGCGCCCATTTCATTGAGTATTACTCGAGTAATACTCAATGAAATGGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_019084.2-702s1c1
Sequence:CCGGCCTGGGTTGTATGACTAATATCTCGAGATATTAGTCATACAACCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_019084.2-974s1c1
Sequence:CCGGCGAGGATTATACTTCGTCTTTCTCGAGAAAGACGAAGTATAATCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_019084.2-1432s1c1
Sequence:CCGGCGGAGTTATCAGATAAATGAACTCGAGTTCATTTATCTGATAACTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019084
VALIDATED
CCNJ MISSION shRNA shRNA Plasmid DNA
cyclin J
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000288843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019084.4-1422s21c1
Sequence:CCGGCGGAGTTATCAGATAAATGAACTCGAGTTCATTTATCTGATAACTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019084.4-1448s21c1
Sequence:CCGGCCCTTGTATTACTCCATGTTTCTCGAGAAACATGGAGTAATACAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019084.4-964s21c1
Sequence:CCGGCGAGGATTATACTTCGTCTTTCTCGAGAAAGACGAAGTATAATCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019084.4-692s21c1
Sequence:CCGGCCTGGGTTGTATGACTAATATCTCGAGATATTAGTCATACAACCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_019084.2-1458s1c1
Sequence:CCGGCCCTTGTATTACTCCATGTTTCTCGAGAAACATGGAGTAATACAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_019084.2-810s1c1
Sequence:CCGGCGCCCATTTCATTGAGTATTACTCGAGTAATACTCAATGAAATGGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_019084.2-702s1c1
Sequence:CCGGCCTGGGTTGTATGACTAATATCTCGAGATATTAGTCATACAACCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_019084.2-974s1c1
Sequence:CCGGCGAGGATTATACTTCGTCTTTCTCGAGAAAGACGAAGTATAATCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_019084.2-1432s1c1
Sequence:CCGGCGGAGTTATCAGATAAATGAACTCGAGTTCATTTATCTGATAACTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019084
VALIDATED
CCNJ MISSION shRNA Lentiviral Transduction Particles
cyclin J
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000288843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019084.4-1422s21c1
Sequence:CCGGCGGAGTTATCAGATAAATGAACTCGAGTTCATTTATCTGATAACTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019084.4-1448s21c1
Sequence:CCGGCCCTTGTATTACTCCATGTTTCTCGAGAAACATGGAGTAATACAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019084.4-964s21c1
Sequence:CCGGCGAGGATTATACTTCGTCTTTCTCGAGAAAGACGAAGTATAATCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_019084.4-692s21c1
Sequence:CCGGCCTGGGTTGTATGACTAATATCTCGAGATATTAGTCATACAACCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_019084.2-1458s1c1
Sequence:CCGGCCCTTGTATTACTCCATGTTTCTCGAGAAACATGGAGTAATACAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_019084.2-810s1c1
Sequence:CCGGCGCCCATTTCATTGAGTATTACTCGAGTAATACTCAATGAAATGGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_019084.2-702s1c1
Sequence:CCGGCCTGGGTTGTATGACTAATATCTCGAGATATTAGTCATACAACCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_019084.2-974s1c1
Sequence:CCGGCGAGGATTATACTTCGTCTTTCTCGAGAAAGACGAAGTATAATCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_019084.2-1432s1c1
Sequence:CCGGCGGAGTTATCAGATAAATGAACTCGAGTTCATTTATCTGATAACTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172839
CCNJ MISSION shRNA Bacterial Glycerol Stock
cyclin J
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124379    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172839.1-2471s1c1
Sequence:CCGGCCGGGAGACAAGTCTTTGTATCTCGAGATACAAAGACTTGTCTCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172839.1-948s1c1
Sequence:CCGGGCTCACGATAACGACGTGAAACTCGAGTTTCACGTCGTTATCGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172839.1-1290s1c1
Sequence:CCGGCGGAGTTACCAGATAAACGAACTCGAGTTCGTTTATCTGGTAACTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172839.1-423s1c1
Sequence:CCGGGACCGCTATGACATCTCCATTCTCGAGAATGGAGATGTCATAGCGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172839.1-781s1c1
Sequence:CCGGTGCAAGATTATGCCTTTCTAACTCGAGTTAGAAAGGCATAATCTTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172839
CCNJ MISSION shRNA shRNA Plasmid DNA
cyclin J
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124379    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172839.1-2471s1c1
Sequence:CCGGCCGGGAGACAAGTCTTTGTATCTCGAGATACAAAGACTTGTCTCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172839.1-948s1c1
Sequence:CCGGGCTCACGATAACGACGTGAAACTCGAGTTTCACGTCGTTATCGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172839.1-1290s1c1
Sequence:CCGGCGGAGTTACCAGATAAACGAACTCGAGTTCGTTTATCTGGTAACTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172839.1-423s1c1
Sequence:CCGGGACCGCTATGACATCTCCATTCTCGAGAATGGAGATGTCATAGCGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172839.1-781s1c1
Sequence:CCGGTGCAAGATTATGCCTTTCTAACTCGAGTTAGAAAGGCATAATCTTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172839
CCNJ MISSION shRNA Lentiviral Transduction Particles
cyclin J
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124379    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172839.1-2471s1c1
Sequence:CCGGCCGGGAGACAAGTCTTTGTATCTCGAGATACAAAGACTTGTCTCCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172839.1-948s1c1
Sequence:CCGGGCTCACGATAACGACGTGAAACTCGAGTTTCACGTCGTTATCGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172839.1-1290s1c1
Sequence:CCGGCGGAGTTACCAGATAAACGAACTCGAGTTCGTTTATCTGGTAACTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172839.1-423s1c1
Sequence:CCGGGACCGCTATGACATCTCCATTCTCGAGAATGGAGATGTCATAGCGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172839.1-781s1c1
Sequence:CCGGTGCAAGATTATGCCTTTCTAACTCGAGTTAGAAAGGCATAATCTTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)