EMAIL THIS PAGE TO A FRIEND

CCNJL

cyclin J-like

129 Gene Product Result for
UniProtKB ID: Q8IV13, Q6ZN43, Q9H7W8
Gene ID:
Mouse(380694) cyclin J-like
Rat(303059) cyclin J-like
sheep(101115368) cyclin J-like
chicken(416155) cyclin J-like
dog(489151) cyclin J-like
domestic cat(101083239) cyclin J-like
cow(100296837) cyclin J-like
Horse(100071011) cyclin J-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024565 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024565 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024565 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001045530 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001045530 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001045530 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU131791 MISSION® esiRNA esiRNA human CCNJL (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024565 Rosetta Predictions human pricing
NM_001037773 Rosetta Predictions rat pricing
NM_001045530 Rosetta Predictions mouse pricing
XM_987173 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024565 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076882 predicted 948
2 SASI_Hs01_00076883 predicted 942
3 SASI_Hs01_00076884 predicted 931
4 SASI_Hs01_00076885 predicted 1090
5 SASI_Hs01_00076886 predicted 1878
6 SASI_Hs01_00076887 predicted 1435
7 SASI_Hs01_00076888 predicted 1618
8 SASI_Hs01_00076889 predicted 967
9 SASI_Hs01_00076890 predicted 1301
10 SASI_Hs01_00076891 predicted 1714
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037773 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204559 predicted 689
2 SASI_Rn02_00204560 predicted 1541
3 SASI_Rn02_00204561 predicted 289
4 SASI_Rn02_00204562 predicted 550
5 SASI_Rn02_00204563 predicted 1653
6 SASI_Rn02_00204564 predicted 1550
7 SASI_Rn02_00204565 predicted 404
8 SASI_Rn02_00204566 predicted 324
9 SASI_Rn02_00204567 predicted 1657
10 SASI_Rn02_00204568 predicted 198
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001045530 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291644 predicted 404
2 SASI_Mm02_00291645 predicted 1414
3 SASI_Mm02_00291646 predicted 526
4 SASI_Mm02_00291647 predicted 773
5 SASI_Mm02_00291648 predicted 531
6 SASI_Mm02_00291649 predicted 1473
7 SASI_Mm02_00291650 predicted 629
8 SASI_Mm02_00291651 predicted 526
9 SASI_Mm02_00291652 predicted 1101
10 SASI_Mm02_00291653 predicted 1474
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_987173 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00218070 predicted 1449
2 SASI_Mm01_00218071 predicted 805
3 SASI_Mm01_00218072 predicted 1457
4 SASI_Mm01_00218073 predicted 570
5 SASI_Mm01_00218074 predicted 1511
6 SASI_Mm01_00218075 predicted 1462
7 SASI_Mm01_00218076 predicted 666
8 SASI_Mm01_00218077 predicted 565
9 SASI_Mm01_00218078 predicted 1130
10 SASI_Mm01_00218079 predicted 1508
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024565
CCNJL MISSION shRNA Bacterial Glycerol Stock
cyclin J-like
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024565.4-936s1c1
Sequence:CCGGCCTCAAGGAGTATGCCCATTACTCGAGTAATGGGCATACTCCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024565.4-1439s1c1
Sequence:CCGGCTGCATCCCTTAGCATGCATACTCGAGTATGCATGCTAAGGGATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157610    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024565.4-569s1c1
Sequence:CCGGGTGGCATGATCTCAGCTCATTCTCGAGAATGAGCTGAGATCATGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024565.4-529s1c1
Sequence:CCGGGCAAACGGAGTTTCGCTCTTACTCGAGTAAGAGCGAAACTCCGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024565.4-967s1c1
Sequence:CCGGGTCACCCTGCAAGATCACATACTCGAGTATGTGATCTTGCAGGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024565.4-1446s1c1
Sequence:CCGGCCTTAGCATGCATATGGCCATCTCGAGATGGCCATATGCATGCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000447152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024565.5-1105s21c1
Sequence:CCGGGAGCACCTCAGCACGTGTATTCTCGAGAATACACGTGCTGAGGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024565.5-456s21c1
Sequence:CCGGCCACTTCATGGATCGCTACAACTCGAGTTGTAGCGATCCATGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024565
CCNJL MISSION shRNA shRNA Plasmid DNA
cyclin J-like
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024565.4-936s1c1
Sequence:CCGGCCTCAAGGAGTATGCCCATTACTCGAGTAATGGGCATACTCCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024565.4-1439s1c1
Sequence:CCGGCTGCATCCCTTAGCATGCATACTCGAGTATGCATGCTAAGGGATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157610    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024565.4-569s1c1
Sequence:CCGGGTGGCATGATCTCAGCTCATTCTCGAGAATGAGCTGAGATCATGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024565.4-529s1c1
Sequence:CCGGGCAAACGGAGTTTCGCTCTTACTCGAGTAAGAGCGAAACTCCGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024565.4-967s1c1
Sequence:CCGGGTCACCCTGCAAGATCACATACTCGAGTATGTGATCTTGCAGGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024565.4-1446s1c1
Sequence:CCGGCCTTAGCATGCATATGGCCATCTCGAGATGGCCATATGCATGCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000447152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024565.5-1105s21c1
Sequence:CCGGGAGCACCTCAGCACGTGTATTCTCGAGAATACACGTGCTGAGGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024565.5-456s21c1
Sequence:CCGGCCACTTCATGGATCGCTACAACTCGAGTTGTAGCGATCCATGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024565
CCNJL MISSION shRNA Lentiviral Transduction Particles
cyclin J-like
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024565.4-936s1c1
Sequence:CCGGCCTCAAGGAGTATGCCCATTACTCGAGTAATGGGCATACTCCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024565.4-1439s1c1
Sequence:CCGGCTGCATCCCTTAGCATGCATACTCGAGTATGCATGCTAAGGGATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157610    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024565.4-569s1c1
Sequence:CCGGGTGGCATGATCTCAGCTCATTCTCGAGAATGAGCTGAGATCATGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024565.4-529s1c1
Sequence:CCGGGCAAACGGAGTTTCGCTCTTACTCGAGTAAGAGCGAAACTCCGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024565.4-967s1c1
Sequence:CCGGGTCACCCTGCAAGATCACATACTCGAGTATGTGATCTTGCAGGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024565.4-1446s1c1
Sequence:CCGGCCTTAGCATGCATATGGCCATCTCGAGATGGCCATATGCATGCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000447152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024565.5-1105s21c1
Sequence:CCGGGAGCACCTCAGCACGTGTATTCTCGAGAATACACGTGCTGAGGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024565.5-456s21c1
Sequence:CCGGCCACTTCATGGATCGCTACAACTCGAGTTGTAGCGATCCATGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001045530
CCNJL MISSION shRNA Bacterial Glycerol Stock
cyclin J-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045530.1-795s21c1
Sequence:CCGGTTACCCTGCAAGATCATATATCTCGAGATATATGATCTTGCAGGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045530.1-520s21c1
Sequence:CCGGGGAAGACCGCGTGCCTAAATTCTCGAGAATTTAGGCACGCGGTCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045530.1-339s21c1
Sequence:CCGGGTCGATTCTTTGTAGACATTCCTCGAGGAATGTCTACAAAGAATCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251363    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045530.1-2480s21c1
Sequence:CCGGGTGCAATATGTTATGACTATGCTCGAGCATAGTCATAACATATTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045530.1-932s21c1
Sequence:CCGGGAGCATCTCAGCACGTGTATCCTCGAGGATACACGTGCTGAGATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001045530
CCNJL MISSION shRNA shRNA Plasmid DNA
cyclin J-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045530.1-795s21c1
Sequence:CCGGTTACCCTGCAAGATCATATATCTCGAGATATATGATCTTGCAGGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045530.1-520s21c1
Sequence:CCGGGGAAGACCGCGTGCCTAAATTCTCGAGAATTTAGGCACGCGGTCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045530.1-339s21c1
Sequence:CCGGGTCGATTCTTTGTAGACATTCCTCGAGGAATGTCTACAAAGAATCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251363    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045530.1-2480s21c1
Sequence:CCGGGTGCAATATGTTATGACTATGCTCGAGCATAGTCATAACATATTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045530.1-932s21c1
Sequence:CCGGGAGCATCTCAGCACGTGTATCCTCGAGGATACACGTGCTGAGATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001045530
CCNJL MISSION shRNA Lentiviral Transduction Particles
cyclin J-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045530.1-795s21c1
Sequence:CCGGTTACCCTGCAAGATCATATATCTCGAGATATATGATCTTGCAGGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045530.1-520s21c1
Sequence:CCGGGGAAGACCGCGTGCCTAAATTCTCGAGAATTTAGGCACGCGGTCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045530.1-339s21c1
Sequence:CCGGGTCGATTCTTTGTAGACATTCCTCGAGGAATGTCTACAAAGAATCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251363    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045530.1-2480s21c1
Sequence:CCGGGTGCAATATGTTATGACTATGCTCGAGCATAGTCATAACATATTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045530.1-932s21c1
Sequence:CCGGGAGCATCTCAGCACGTGTATCCTCGAGGATACACGTGCTGAGATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks