EMAIL THIS PAGE TO A FRIEND

CCNK

cyclin K

110 Gene Product Result for
Synonyms: CPR4
UniProtKB ID: O75909, Q59FT6, Q86U16, Q96B63, Q9NNY9
Gene ID:
Human(8812) Summary: The protein encoded by this gene is a member of the transcription cyclin family. These cyclins may regulate transcription through their association with and activation of cyclin-dependent kinases (CDK) that phosphorylate the C-terminal domain (CTD) of the large subunit of RNA polymerase II. This gene product may play a dual role in regulating CDK and RNA polymerase II activities. [provided by RefSeq, Jul 2008]
Mouse(12454) cyclin K
Rat(500715) cyclin K
cow(530744) cyclin K
dog(612481) cyclin K
chicken(423446) cyclin K
sheep(101117113) cyclin K
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003858 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003858 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003858 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009832 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009832 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009832 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099402 Rosetta Predictions human pricing
NM_003858 Rosetta Predictions human pricing
NM_001109672 Rosetta Predictions rat pricing
XR_008600 Rosetta Predictions rat pricing
NM_009832 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099402 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320549 predicted 219
2 SASI_Hs02_00320550 predicted 520
3 SASI_Hs02_00320551 predicted 766
4 SASI_Hs02_00320552 predicted 664
5 SASI_Hs02_00320553 predicted 578
6 SASI_Hs02_00320554 predicted 544
7 SASI_Hs02_00320555 predicted 569
8 SASI_Hs02_00320556 predicted 795
9 SASI_Hs02_00320557 predicted 625
10 SASI_Hs02_00320558 predicted 490
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003858 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140861 predicted 220
2 SASI_Hs01_00140862 predicted 512
3 SASI_Hs01_00140863 predicted 769
4 SASI_Hs01_00140864 predicted 669
5 SASI_Hs01_00140865 predicted 580
6 SASI_Hs02_00336438 predicted 542
7 SASI_Hs01_00140866 predicted 570
8 SASI_Hs01_00140868 predicted 793
9 SASI_Hs01_00140869 predicted 629
10 SASI_Hs02_00336439 predicted 484
11 SASI_Hs01_00140867 predicted 882
12 SASI_Hs01_00140870 predicted 894
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109672 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250582 predicted 502
2 SASI_Rn02_00250583 predicted 654
3 SASI_Rn02_00250584 predicted 2115
4 SASI_Rn02_00250585 predicted 549
5 SASI_Rn02_00250586 predicted 2157
6 SASI_Rn02_00250587 predicted 497
7 SASI_Rn02_00250588 predicted 654
8 SASI_Rn02_00250589 predicted 2223
9 SASI_Rn02_00250590 predicted 2169
10 SASI_Rn02_00250591 predicted 749
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008600 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00138890 predicted 493
2 SASI_Rn01_00138891 predicted 647
3 SASI_Rn01_00138892 predicted 2041
4 SASI_Rn01_00138893 predicted 550
5 SASI_Rn01_00138894 predicted 2080
6 SASI_Rn01_00138895 predicted 500
7 SASI_Rn01_00138896 predicted 645
8 SASI_Rn01_00138897 predicted 2143
9 SASI_Rn01_00138898 predicted 2090
10 SASI_Rn01_00138899 predicted 340
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009832 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317179 predicted 285
2 SASI_Mm01_00200412 predicted 669
3 SASI_Mm02_00317180 predicted 761
4 SASI_Mm01_00200413 predicted 615
5 SASI_Mm01_00200415 predicted 859
6 SASI_Mm02_00317181 predicted 978
7 SASI_Mm01_00200416 predicted 835
8 SASI_Mm01_00200417 predicted 753
9 SASI_Mm02_00317182 predicted 989
10 SASI_Mm01_00200418 predicted 536
11 SASI_Mm01_00200410 predicted 2035
12 SASI_Mm01_00200411 predicted 2050
13 SASI_Mm01_00200414 predicted 2025
14 SASI_Mm01_00200419 predicted 336
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003858
VALIDATED
CCNK MISSION shRNA Bacterial Glycerol Stock
cyclin K
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000288839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_003858.3-883s21c1
Sequence:CCGGCCACCAAATCCTGGATCTTTACTCGAGTAAAGATCCAGGATTTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003858.3-769s21c1
Sequence:CCGGCGCAGGACGTTTGTGCAAATTCTCGAGAATTTGCACAAACGTCCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_003858.3-193s21c1
Sequence:CCGGGCCATGTTGGTACTGGGATAACTCGAGTTATCCCAGTACCAACATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003858.3-574s21c1
Sequence:CCGGGCAGACCATCAAGTTTGATTTCTCGAGAAATCAAACTTGATGGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003858.3-632s21c1
Sequence:CCGGGCAAAGCAACTCAAAGGTGATCTCGAGATCACCTTTGAGTTGCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003858.2-574s1c1
Sequence:CCGGGCAGACCATCAAGTTTGATTTCTCGAGAAATCAAACTTGATGGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003858.2-193s1c1
Sequence:CCGGGCCATGTTGGTACTGGGATAACTCGAGTTATCCCAGTACCAACATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003858.2-632s1c1
Sequence:CCGGGCAAAGCAACTCAAAGGTGATCTCGAGATCACCTTTGAGTTGCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003858.2-883s1c1
Sequence:CCGGCCACCAAATCCTGGATCTTTACTCGAGTAAAGATCCAGGATTTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003858.2-769s1c1
Sequence:CCGGCGCAGGACGTTTGTGCAAATTCTCGAGAATTTGCACAAACGTCCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003858
VALIDATED
CCNK MISSION shRNA shRNA Plasmid DNA
cyclin K
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000288839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_003858.3-883s21c1
Sequence:CCGGCCACCAAATCCTGGATCTTTACTCGAGTAAAGATCCAGGATTTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003858.3-769s21c1
Sequence:CCGGCGCAGGACGTTTGTGCAAATTCTCGAGAATTTGCACAAACGTCCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_003858.3-193s21c1
Sequence:CCGGGCCATGTTGGTACTGGGATAACTCGAGTTATCCCAGTACCAACATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003858.3-574s21c1
Sequence:CCGGGCAGACCATCAAGTTTGATTTCTCGAGAAATCAAACTTGATGGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003858.3-632s21c1
Sequence:CCGGGCAAAGCAACTCAAAGGTGATCTCGAGATCACCTTTGAGTTGCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003858.2-574s1c1
Sequence:CCGGGCAGACCATCAAGTTTGATTTCTCGAGAAATCAAACTTGATGGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003858.2-193s1c1
Sequence:CCGGGCCATGTTGGTACTGGGATAACTCGAGTTATCCCAGTACCAACATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003858.2-632s1c1
Sequence:CCGGGCAAAGCAACTCAAAGGTGATCTCGAGATCACCTTTGAGTTGCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003858.2-883s1c1
Sequence:CCGGCCACCAAATCCTGGATCTTTACTCGAGTAAAGATCCAGGATTTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003858.2-769s1c1
Sequence:CCGGCGCAGGACGTTTGTGCAAATTCTCGAGAATTTGCACAAACGTCCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003858
VALIDATED
CCNK MISSION shRNA Lentiviral Transduction Particles
cyclin K
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000288839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_003858.3-883s21c1
Sequence:CCGGCCACCAAATCCTGGATCTTTACTCGAGTAAAGATCCAGGATTTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003858.3-769s21c1
Sequence:CCGGCGCAGGACGTTTGTGCAAATTCTCGAGAATTTGCACAAACGTCCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_003858.3-193s21c1
Sequence:CCGGGCCATGTTGGTACTGGGATAACTCGAGTTATCCCAGTACCAACATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003858.3-574s21c1
Sequence:CCGGGCAGACCATCAAGTTTGATTTCTCGAGAAATCAAACTTGATGGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003858.3-632s21c1
Sequence:CCGGGCAAAGCAACTCAAAGGTGATCTCGAGATCACCTTTGAGTTGCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003858.2-574s1c1
Sequence:CCGGGCAGACCATCAAGTTTGATTTCTCGAGAAATCAAACTTGATGGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003858.2-193s1c1
Sequence:CCGGGCCATGTTGGTACTGGGATAACTCGAGTTATCCCAGTACCAACATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003858.2-632s1c1
Sequence:CCGGGCAAAGCAACTCAAAGGTGATCTCGAGATCACCTTTGAGTTGCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003858.2-883s1c1
Sequence:CCGGCCACCAAATCCTGGATCTTTACTCGAGTAAAGATCCAGGATTTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003858.2-769s1c1
Sequence:CCGGCGCAGGACGTTTGTGCAAATTCTCGAGAATTTGCACAAACGTCCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009832
CCNK MISSION shRNA Bacterial Glycerol Stock
cyclin K
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009832.1-2029s1c1
Sequence:CCGGGCTCAGTTAATAGCTTCAGTACTCGAGTACTGAAGCTATTAACTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009832.1-329s1c1
Sequence:CCGGCCCTGGCAAATGGAATCATTTCTCGAGAAATGATTCCATTTGCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009832.1-564s1c1
Sequence:CCGGGCAGACCATAAAGTTTGACTTCTCGAGAAGTCAAACTTTATGGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009832.1-565s1c1
Sequence:CCGGCAGACCATAAAGTTTGACTTACTCGAGTAAGTCAAACTTTATGGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009832.1-760s1c1
Sequence:CCGGGCGGGACGTTTGTGCAAATTTCTCGAGAAATTTGCACAAACGTCCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009832
CCNK MISSION shRNA shRNA Plasmid DNA
cyclin K
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009832.1-2029s1c1
Sequence:CCGGGCTCAGTTAATAGCTTCAGTACTCGAGTACTGAAGCTATTAACTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009832.1-329s1c1
Sequence:CCGGCCCTGGCAAATGGAATCATTTCTCGAGAAATGATTCCATTTGCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009832.1-564s1c1
Sequence:CCGGGCAGACCATAAAGTTTGACTTCTCGAGAAGTCAAACTTTATGGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009832.1-565s1c1
Sequence:CCGGCAGACCATAAAGTTTGACTTACTCGAGTAAGTCAAACTTTATGGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009832.1-760s1c1
Sequence:CCGGGCGGGACGTTTGTGCAAATTTCTCGAGAAATTTGCACAAACGTCCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009832
CCNK MISSION shRNA Lentiviral Transduction Particles
cyclin K
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009832.1-2029s1c1
Sequence:CCGGGCTCAGTTAATAGCTTCAGTACTCGAGTACTGAAGCTATTAACTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009832.1-329s1c1
Sequence:CCGGCCCTGGCAAATGGAATCATTTCTCGAGAAATGATTCCATTTGCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009832.1-564s1c1
Sequence:CCGGGCAGACCATAAAGTTTGACTTCTCGAGAAGTCAAACTTTATGGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009832.1-565s1c1
Sequence:CCGGCAGACCATAAAGTTTGACTTACTCGAGTAAGTCAAACTTTATGGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009832.1-760s1c1
Sequence:CCGGGCGGGACGTTTGTGCAAATTTCTCGAGAAATTTGCACAAACGTCCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)