EMAIL THIS PAGE TO A FRIEND

CCNL1

cyclin L1

85 Gene Product Result for
Synonyms: ANIA6A PRO1073 ania-6a
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019937 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019937 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019937 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020307 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020307 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020307 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU080091 MISSION® esiRNA esiRNA targeting mouse Ccnl1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020307 Rosetta Predictions human pricing
NM_053662 Rosetta Predictions rat pricing
NM_019937 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020307 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143030 predicted 2106
2 SASI_Hs01_00143031 predicted 1036
3 SASI_Hs01_00143034 predicted 961
4 SASI_Hs01_00143035 predicted 1933
5 SASI_Hs01_00143037 predicted 1210
6 SASI_Hs01_00143038 predicted 2215
7 SASI_Hs02_00353219 predicted 1917
8 SASI_Hs02_00353220 predicted 1805
9 SASI_Hs01_00143039 predicted 942
10 SASI_Hs02_00353221 predicted 1009
11 SASI_Hs01_00143032 predicted 1207
12 SASI_Hs01_00143033 predicted 1819
13 SASI_Hs01_00143036 predicted 965
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053662 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057165 predicted 1442
2 SASI_Rn01_00057166 predicted 1719
3 SASI_Rn01_00057167 predicted 1463
4 SASI_Rn01_00057168 predicted 929
5 SASI_Rn01_00057169 predicted 805
6 SASI_Rn01_00057170 predicted 1544
7 SASI_Rn01_00057171 predicted 736
8 SASI_Rn02_00266394 predicted 1605
9 SASI_Rn01_00057172 predicted 1211
10 SASI_Rn01_00057173 predicted 918
11 SASI_Rn01_00057174 predicted 530
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019937 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023407 predicted 953
2 SASI_Mm01_00023408 predicted 1491
3 SASI_Mm01_00023409 predicted 761
4 SASI_Mm01_00023410 predicted 546
5 SASI_Mm01_00023412 predicted 477
6 SASI_Mm01_00023413 predicted 825
7 SASI_Mm01_00023414 predicted 1433
8 SASI_Mm01_00023415 predicted 1277
9 SASI_Mm02_00325232 predicted 951
10 SASI_Mm01_00023416 predicted 987
11 SASI_Mm01_00023411 predicted 1470
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019937
VALIDATED
CCNL1 MISSION shRNA Bacterial Glycerol Stock
cyclin L1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019937.1-1189s1c1
Sequence:CCGGGCCCTTACAATGGTGTAAGAACTCGAGTTCTTACACCATTGTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019937.1-1048s1c1
Sequence:CCGGCCCTTTCAACTCTTGGTGGATCTCGAGATCCACCAAGAGTTGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019937.1-1444s1c1
Sequence:CCGGGCTCAAATAGACACGGTCATACTCGAGTATGACCGTGTCTATTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019937.1-460s1c1
Sequence:CCGGCCTGTATTAATCTTGCGTCAACTCGAGTTGACGCAAGATTAATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019937.1-1313s1c1
Sequence:CCGGGCGAAGTCGATCTGGAACATACTCGAGTATGTTCCAGATCGACTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019937.3-1756s21c1
Sequence:CCGGGTGGACTCAATCGAAACATAACTCGAGTTATGTTTCGATTGAGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019937.3-1626s21c1
Sequence:CCGGCCTTTGAGAGGTCCCATAAAGCTCGAGCTTTATGGGACCTCTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019937.3-1042s21c1
Sequence:CCGGCTTACAGGAAGCCAAGTTAAACTCGAGTTTAACTTGGCTTCCTGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019937.3-1421s21c1
Sequence:CCGGAGCCCTCGAAGACATCATAATCTCGAGATTATGATGTCTTCGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019937.3-961s21c1
Sequence:CCGGCATAGAGACGCTTAGACTTTACTCGAGTAAAGTCTAAGCGTCTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019937
VALIDATED
CCNL1 MISSION shRNA shRNA Plasmid DNA
cyclin L1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019937.1-1189s1c1
Sequence:CCGGGCCCTTACAATGGTGTAAGAACTCGAGTTCTTACACCATTGTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019937.1-1048s1c1
Sequence:CCGGCCCTTTCAACTCTTGGTGGATCTCGAGATCCACCAAGAGTTGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019937.1-1444s1c1
Sequence:CCGGGCTCAAATAGACACGGTCATACTCGAGTATGACCGTGTCTATTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019937.1-460s1c1
Sequence:CCGGCCTGTATTAATCTTGCGTCAACTCGAGTTGACGCAAGATTAATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019937.1-1313s1c1
Sequence:CCGGGCGAAGTCGATCTGGAACATACTCGAGTATGTTCCAGATCGACTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019937.3-1756s21c1
Sequence:CCGGGTGGACTCAATCGAAACATAACTCGAGTTATGTTTCGATTGAGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019937.3-1626s21c1
Sequence:CCGGCCTTTGAGAGGTCCCATAAAGCTCGAGCTTTATGGGACCTCTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019937.3-1042s21c1
Sequence:CCGGCTTACAGGAAGCCAAGTTAAACTCGAGTTTAACTTGGCTTCCTGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019937.3-1421s21c1
Sequence:CCGGAGCCCTCGAAGACATCATAATCTCGAGATTATGATGTCTTCGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019937.3-961s21c1
Sequence:CCGGCATAGAGACGCTTAGACTTTACTCGAGTAAAGTCTAAGCGTCTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019937
VALIDATED
CCNL1 MISSION shRNA Lentiviral Transduction Particles
cyclin L1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019937.1-1189s1c1
Sequence:CCGGGCCCTTACAATGGTGTAAGAACTCGAGTTCTTACACCATTGTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019937.1-1048s1c1
Sequence:CCGGCCCTTTCAACTCTTGGTGGATCTCGAGATCCACCAAGAGTTGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019937.1-1444s1c1
Sequence:CCGGGCTCAAATAGACACGGTCATACTCGAGTATGACCGTGTCTATTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019937.1-460s1c1
Sequence:CCGGCCTGTATTAATCTTGCGTCAACTCGAGTTGACGCAAGATTAATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019937.1-1313s1c1
Sequence:CCGGGCGAAGTCGATCTGGAACATACTCGAGTATGTTCCAGATCGACTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019937.3-1756s21c1
Sequence:CCGGGTGGACTCAATCGAAACATAACTCGAGTTATGTTTCGATTGAGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019937.3-1626s21c1
Sequence:CCGGCCTTTGAGAGGTCCCATAAAGCTCGAGCTTTATGGGACCTCTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019937.3-1042s21c1
Sequence:CCGGCTTACAGGAAGCCAAGTTAAACTCGAGTTTAACTTGGCTTCCTGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019937.3-1421s21c1
Sequence:CCGGAGCCCTCGAAGACATCATAATCTCGAGATTATGATGTCTTCGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019937.3-961s21c1
Sequence:CCGGCATAGAGACGCTTAGACTTTACTCGAGTAAAGTCTAAGCGTCTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020307
VALIDATED
CCNL1 MISSION shRNA Bacterial Glycerol Stock
cyclin L1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_020307.2-2219s1c1
Sequence:CCGGGCCTATCTACAGTGTGATGTACTCGAGTACATCACACTGTAGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020307.2-1721s1c1
Sequence:CCGGCCCTTACAATGGTGTAAGAAACTCGAGTTTCTTACACCATTGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020307.2-920s1c1
Sequence:CCGGGCAGGTGTTGTTTCATCGTTTCTCGAGAAACGATGAAACAACACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020307.2-1947s1c1
Sequence:CCGGGCCAAGCATACCAGAGATGATCTCGAGATCATCTCTGGTATGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_020307.2-1524s1c1
Sequence:CCGGGCCTTACAAGAAGCCAAATTACTCGAGTAATTTGGCTTCTTGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234691    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020307.2-2368s21c1
Sequence:CCGGGCCCTAGCAGTATCTAATTAACTCGAGTTAATTAGATACTGCTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020307.2-1905s21c1
Sequence:CCGGAGCCCTCGAAGACATCATAATCTCGAGATTATGATGTCTTCGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020307.2-1977s21c1
Sequence:CCGGTCAAACAGACATGGTCATAAACTCGAGTTTATGACCATGTCTGTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020307.2-1818s21c1
Sequence:CCGGACTCCAAGAAGACACTATAATCTCGAGATTATAGTGTCTTCTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020307
VALIDATED
CCNL1 MISSION shRNA shRNA Plasmid DNA
cyclin L1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_020307.2-2219s1c1
Sequence:CCGGGCCTATCTACAGTGTGATGTACTCGAGTACATCACACTGTAGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020307.2-1721s1c1
Sequence:CCGGCCCTTACAATGGTGTAAGAAACTCGAGTTTCTTACACCATTGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020307.2-920s1c1
Sequence:CCGGGCAGGTGTTGTTTCATCGTTTCTCGAGAAACGATGAAACAACACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020307.2-1947s1c1
Sequence:CCGGGCCAAGCATACCAGAGATGATCTCGAGATCATCTCTGGTATGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_020307.2-1524s1c1
Sequence:CCGGGCCTTACAAGAAGCCAAATTACTCGAGTAATTTGGCTTCTTGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234691    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020307.2-2368s21c1
Sequence:CCGGGCCCTAGCAGTATCTAATTAACTCGAGTTAATTAGATACTGCTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020307.2-1905s21c1
Sequence:CCGGAGCCCTCGAAGACATCATAATCTCGAGATTATGATGTCTTCGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020307.2-1977s21c1
Sequence:CCGGTCAAACAGACATGGTCATAAACTCGAGTTTATGACCATGTCTGTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020307.2-1818s21c1
Sequence:CCGGACTCCAAGAAGACACTATAATCTCGAGATTATAGTGTCTTCTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020307
VALIDATED
CCNL1 MISSION shRNA Lentiviral Transduction Particles
cyclin L1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_020307.2-2219s1c1
Sequence:CCGGGCCTATCTACAGTGTGATGTACTCGAGTACATCACACTGTAGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020307.2-1721s1c1
Sequence:CCGGCCCTTACAATGGTGTAAGAAACTCGAGTTTCTTACACCATTGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020307.2-920s1c1
Sequence:CCGGGCAGGTGTTGTTTCATCGTTTCTCGAGAAACGATGAAACAACACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020307.2-1947s1c1
Sequence:CCGGGCCAAGCATACCAGAGATGATCTCGAGATCATCTCTGGTATGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_020307.2-1524s1c1
Sequence:CCGGGCCTTACAAGAAGCCAAATTACTCGAGTAATTTGGCTTCTTGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234691    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020307.2-2368s21c1
Sequence:CCGGGCCCTAGCAGTATCTAATTAACTCGAGTTAATTAGATACTGCTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020307.2-1905s21c1
Sequence:CCGGAGCCCTCGAAGACATCATAATCTCGAGATTATGATGTCTTCGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020307.2-1977s21c1
Sequence:CCGGTCAAACAGACATGGTCATAAACTCGAGTTTATGACCATGTCTGTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020307.2-1818s21c1
Sequence:CCGGACTCCAAGAAGACACTATAATCTCGAGATTATAGTGTCTTCTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks