EMAIL THIS PAGE TO A FRIEND

CCNL2

cyclin L2

185 Gene Product Result for
Synonyms: ANIA-6B CCNM HCLA-ISO HLA-ISO PCEE SB138
Gene ID:
Human(81669) Summary: The protein encoded by this gene belongs to the cyclin family. Through its interaction with several proteins, such as RNA polymerase II, splicing factors, and cyclin-dependent kinases, this protein functions as a regulator of the pre-mRNA splicing process, as well as in inducing apoptosis by modulating the expression of apoptotic and antiapoptotic proteins. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Mouse(56036) cyclin L2
Rat(298686) cyclin L2
chicken(395124) cyclin L2
dog(479570) cyclin L2
cow(538796) cyclin L2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV50695 Anti-CCNL2 antibody produced in rabbit affinity isolated antibody mouse, human, canine, rabbit, guinea pig, rat, horse
western blot pricing
SAB2900321 Anti-CCNL2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
immunofluorescence, immunohistochemistry, immunoprecipitation pricing
HPA053137 Anti-CCNL2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207678 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207678 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207678 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030937 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030937 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030937 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU195551 MISSION® esiRNA esiRNA targeting mouse Ccnl2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039577 Rosetta Predictions human pricing
NM_030937 Rosetta Predictions human pricing
NM_001013094 Rosetta Predictions rat pricing
NM_207678 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039577 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308571 predicted 856
2 SASI_Hs02_00308572 predicted 856
3 SASI_Hs02_00308573 predicted 581
4 SASI_Hs02_00308574 predicted 883
5 SASI_Hs01_00052525 predicted 611
6 SASI_Hs02_00308575 predicted 831
7 SASI_Hs02_00308576 predicted 932
8 SASI_Hs02_00308577 predicted 877
9 SASI_Hs02_00308578 predicted 630
10 SASI_Hs02_00308579 predicted 582
11 SASI_Hs01_00052518 predicted 740
12 SASI_Hs01_00052519 predicted 538
13 SASI_Hs01_00052520 predicted 459
14 SASI_Hs01_00052521 predicted 424
15 SASI_Hs01_00052522 predicted 489
16 SASI_Hs01_00052523 predicted 542
17 SASI_Hs01_00052524 predicted 713
18 SASI_Hs01_00052526 predicted 527
19 SASI_Hs01_00052527 predicted 489
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030937 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358503 predicted 1923
2 SASI_Hs02_00358504 predicted 1665
3 SASI_Hs02_00358505 predicted 1716
4 SASI_Hs02_00358506 predicted 1822
5 SASI_Hs02_00358507 predicted 1715
6 SASI_Hs02_00358508 predicted 1967
7 SASI_Hs02_00358509 predicted 1973
8 SASI_Hs02_00358510 predicted 2006
9 SASI_Hs02_00358511 predicted 1927
10 SASI_Hs01_00023449 predicted 1372
11 SASI_Hs01_00023440 predicted 492
12 SASI_Hs01_00023441 predicted 545
13 SASI_Hs01_00023442 predicted 493
14 SASI_Hs01_00023443 predicted 586
15 SASI_Hs01_00023444 predicted 617
16 SASI_Hs01_00023445 predicted 524
17 SASI_Hs01_00023446 predicted 1316
18 SASI_Hs01_00023447 predicted 1094
19 SASI_Hs01_00023448 predicted 655
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013094 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088232 predicted 832
2 SASI_Rn01_00088234 predicted 644
3 SASI_Rn01_00088235 predicted 773
4 SASI_Rn01_00088236 predicted 416
5 SASI_Rn02_00200748 predicted 774
6 SASI_Rn02_00200749 predicted 856
7 SASI_Rn01_00088237 predicted 604
8 SASI_Rn01_00088240 predicted 618
9 SASI_Rn01_00088241 predicted 694
10 SASI_Rn02_00200750 predicted 735
11 SASI_Rn01_00088233 predicted 862
12 SASI_Rn01_00088238 predicted 820
13 SASI_Rn01_00088239 predicted 507
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207678 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106122 predicted 1133
2 SASI_Mm01_00106123 predicted 645
3 SASI_Mm01_00106124 predicted 1381
4 SASI_Mm01_00106125 predicted 538
5 SASI_Mm01_00106126 predicted 1080
6 SASI_Mm01_00106127 predicted 660
7 SASI_Mm01_00106128 predicted 797
8 SASI_Mm01_00106129 predicted 1489
9 SASI_Mm01_00106130 predicted 744
10 SASI_Mm02_00352213 predicted 1490
11 SASI_Mm01_00106131 predicted 526
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207678
VALIDATED
CCNL2 MISSION shRNA Bacterial Glycerol Stock
cyclin L2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207678.1-798s21c1
Sequence:CCGGTTTACCCAATCGTCCACATTGCTCGAGCAATGTGGACGATTGGGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262719    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207678.1-1764s21c1
Sequence:CCGGGTGCATCTGTCCCGGTTAATGCTCGAGCATTAACCGGGACAGATGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207678.1-1516s21c1
Sequence:CCGGCGTGAGCGCTCAAGGTCATATCTCGAGATATGACCTTGAGCGCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207678.1-545s21c1
Sequence:CCGGACCTAAAGAACCAGATTATAACTCGAGTTATAATCTGGTTCTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207678.1-365s21c1
Sequence:CCGGACACTAAGTCCTTCGTGAAACCTCGAGGTTTCACGAAGGACTTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207678.1-618s1c1
Sequence:CCGGCCCTCACAAGATAATCGTTATCTCGAGATAACGATTATCTTGTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207678.1-1368s1c1
Sequence:CCGGCCGGAAATCAAAGGACTGCAACTCGAGTTGCAGTCCTTTGATTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207678.1-1137s1c1
Sequence:CCGGCCCTGTAAATGGCTTGCTGAACTCGAGTTCAGCAAGCCATTTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207678.1-1225s1c1
Sequence:CCGGGCTTCTCCAAAGAGAAGGAAACTCGAGTTTCCTTCTCTTTGGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207678.1-447s1c1
Sequence:CCGGGAGACGAATCAGGGATGTCATCTCGAGATGACATCCCTGATTCGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207678
VALIDATED
CCNL2 MISSION shRNA shRNA Plasmid DNA
cyclin L2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207678.1-798s21c1
Sequence:CCGGTTTACCCAATCGTCCACATTGCTCGAGCAATGTGGACGATTGGGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262719    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207678.1-1764s21c1
Sequence:CCGGGTGCATCTGTCCCGGTTAATGCTCGAGCATTAACCGGGACAGATGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207678.1-1516s21c1
Sequence:CCGGCGTGAGCGCTCAAGGTCATATCTCGAGATATGACCTTGAGCGCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207678.1-545s21c1
Sequence:CCGGACCTAAAGAACCAGATTATAACTCGAGTTATAATCTGGTTCTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207678.1-365s21c1
Sequence:CCGGACACTAAGTCCTTCGTGAAACCTCGAGGTTTCACGAAGGACTTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207678.1-618s1c1
Sequence:CCGGCCCTCACAAGATAATCGTTATCTCGAGATAACGATTATCTTGTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207678.1-1368s1c1
Sequence:CCGGCCGGAAATCAAAGGACTGCAACTCGAGTTGCAGTCCTTTGATTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207678.1-1137s1c1
Sequence:CCGGCCCTGTAAATGGCTTGCTGAACTCGAGTTCAGCAAGCCATTTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207678.1-1225s1c1
Sequence:CCGGGCTTCTCCAAAGAGAAGGAAACTCGAGTTTCCTTCTCTTTGGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207678.1-447s1c1
Sequence:CCGGGAGACGAATCAGGGATGTCATCTCGAGATGACATCCCTGATTCGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207678
VALIDATED
CCNL2 MISSION shRNA Lentiviral Transduction Particles
cyclin L2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207678.1-798s21c1
Sequence:CCGGTTTACCCAATCGTCCACATTGCTCGAGCAATGTGGACGATTGGGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262719    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207678.1-1764s21c1
Sequence:CCGGGTGCATCTGTCCCGGTTAATGCTCGAGCATTAACCGGGACAGATGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207678.1-1516s21c1
Sequence:CCGGCGTGAGCGCTCAAGGTCATATCTCGAGATATGACCTTGAGCGCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207678.1-545s21c1
Sequence:CCGGACCTAAAGAACCAGATTATAACTCGAGTTATAATCTGGTTCTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207678.1-365s21c1
Sequence:CCGGACACTAAGTCCTTCGTGAAACCTCGAGGTTTCACGAAGGACTTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207678.1-618s1c1
Sequence:CCGGCCCTCACAAGATAATCGTTATCTCGAGATAACGATTATCTTGTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207678.1-1368s1c1
Sequence:CCGGCCGGAAATCAAAGGACTGCAACTCGAGTTGCAGTCCTTTGATTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207678.1-1137s1c1
Sequence:CCGGCCCTGTAAATGGCTTGCTGAACTCGAGTTCAGCAAGCCATTTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207678.1-1225s1c1
Sequence:CCGGGCTTCTCCAAAGAGAAGGAAACTCGAGTTTCCTTCTCTTTGGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207678.1-447s1c1
Sequence:CCGGGAGACGAATCAGGGATGTCATCTCGAGATGACATCCCTGATTCGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030937
CCNL2 MISSION shRNA Bacterial Glycerol Stock
cyclin L2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030937.2-1546s1c1
Sequence:CCGGGCCTACCAGATTCTGGTGATTCTCGAGAATCACCAGAATCTGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030937.2-1830s1c1
Sequence:CCGGGCGTCTCCTAAGAGGAGGAAACTCGAGTTTCCTCCTCTTAGGAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030937.2-1944s1c1
Sequence:CCGGCCCTACAAAGGCTCTGAGATTCTCGAGAATCTCAGAGCCTTTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030937.2-1325s1c1
Sequence:CCGGCTTGCAGCTTTATGCTCGGAACTCGAGTTCCGAGCATAAAGCTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030937.2-1481s1c1
Sequence:CCGGGTGGTCTCAATGTATTGACTTCTCGAGAAGTCAATACATTGAGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030937
CCNL2 MISSION shRNA shRNA Plasmid DNA
cyclin L2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030937.2-1546s1c1
Sequence:CCGGGCCTACCAGATTCTGGTGATTCTCGAGAATCACCAGAATCTGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030937.2-1830s1c1
Sequence:CCGGGCGTCTCCTAAGAGGAGGAAACTCGAGTTTCCTCCTCTTAGGAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030937.2-1944s1c1
Sequence:CCGGCCCTACAAAGGCTCTGAGATTCTCGAGAATCTCAGAGCCTTTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030937.2-1325s1c1
Sequence:CCGGCTTGCAGCTTTATGCTCGGAACTCGAGTTCCGAGCATAAAGCTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030937.2-1481s1c1
Sequence:CCGGGTGGTCTCAATGTATTGACTTCTCGAGAAGTCAATACATTGAGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030937
CCNL2 MISSION shRNA Lentiviral Transduction Particles
cyclin L2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030937.2-1546s1c1
Sequence:CCGGGCCTACCAGATTCTGGTGATTCTCGAGAATCACCAGAATCTGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030937.2-1830s1c1
Sequence:CCGGGCGTCTCCTAAGAGGAGGAAACTCGAGTTTCCTCCTCTTAGGAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030937.2-1944s1c1
Sequence:CCGGCCCTACAAAGGCTCTGAGATTCTCGAGAATCTCAGAGCCTTTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030937.2-1325s1c1
Sequence:CCGGCTTGCAGCTTTATGCTCGGAACTCGAGTTCCGAGCATAAAGCTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030937.2-1481s1c1
Sequence:CCGGGTGGTCTCAATGTATTGACTTCTCGAGAAGTCAATACATTGAGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks