EMAIL THIS PAGE TO A FRIEND

CCNO

cyclin O

72 Gene Product Result for
Synonyms: CCNU UDG2
UniProtKB ID: P22674, A8K1W5, Q0P6J2, Q9H6B0, Q9UMD5
Gene ID:
Human(10309) Summary: This gene, which has a previous symbol of UNG2, was erroneously identified as a uracil DNA glycosylase in PubMed ID: 2001396. A later publication, PubMed ID: 8419333, identified this gene's product as a cyclin protein family member. The UNG2 term is also used as a specific protein isoform name for the UNG gene (GeneID 7374), so confusion exists in the scientific literature and in some databases for these two genes.[provided by RefSeq, Nov 2010]
Mouse(218630) cyclin O
Rat(499528) cyclin O
sheep(101115826) cyclin O
cow(100301247) cyclin O
dog(487208) cyclin O
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021147 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021147 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021147 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_127523 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_127523 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_127523 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024592 Rosetta Predictions human pricing
NM_021147 Rosetta Predictions human pricing
NM_001109175 Rosetta Predictions rat pricing
NM_001081062 Rosetta Predictions mouse pricing
XM_127523 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024592 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032259 predicted 237
2 SASI_Hs01_00032260 predicted 226
3 SASI_Hs01_00032261 predicted 219
4 SASI_Hs01_00032262 predicted 224
5 SASI_Hs01_00032263 predicted 237
6 SASI_Hs01_00032264 predicted 235
7 SASI_Hs01_00032265 predicted 383
8 SASI_Hs01_00032266 predicted 883
9 SASI_Hs01_00032267 predicted 1458
10 SASI_Hs01_00032268 predicted 1639
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021147 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169494 predicted 1160
2 SASI_Hs02_00354678 predicted 856
3 SASI_Hs02_00354679 predicted 320
4 SASI_Hs01_00169495 predicted 1146
5 SASI_Hs01_00169497 predicted 309
6 SASI_Hs02_00354680 predicted 467
7 SASI_Hs02_00354681 predicted 590
8 SASI_Hs01_00169500 predicted 1129
9 SASI_Hs02_00354682 predicted 1136
10 SASI_Hs02_00354683 predicted 693
11 SASI_Hs01_00169493 predicted 1158
12 SASI_Hs01_00169496 predicted 1133
13 SASI_Hs01_00169498 predicted 306
14 SASI_Hs01_00169499 predicted 298
15 SASI_Hs01_00169501 predicted 311
16 SASI_Hs01_00169502 predicted 1135
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109175 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245860 predicted 1410
2 SASI_Rn02_00245861 predicted 2042
3 SASI_Rn02_00245862 predicted 2017
4 SASI_Rn02_00245863 predicted 1866
5 SASI_Rn02_00245864 predicted 1810
6 SASI_Rn02_00245865 predicted 1772
7 SASI_Rn02_00245866 predicted 1816
8 SASI_Rn02_00245867 predicted 1854
9 SASI_Rn02_00245868 predicted 2002
10 SASI_Rn02_00245869 predicted 1873
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081062 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294801 predicted 1470
2 SASI_Mm02_00294802 predicted 1062
3 SASI_Mm02_00294803 predicted 1314
4 SASI_Mm02_00294804 predicted 1367
5 SASI_Mm02_00294805 predicted 482
6 SASI_Mm02_00294806 predicted 896
7 SASI_Mm02_00294807 predicted 1384
8 SASI_Mm02_00294808 predicted 234
9 SASI_Mm02_00294809 predicted 408
10 SASI_Mm02_00294810 predicted 245
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_127523 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00222505 predicted 1063
2 SASI_Mm01_00222506 predicted 1315
3 SASI_Mm01_00222507 predicted 1339
4 SASI_Mm01_00222508 predicted 335
5 SASI_Mm01_00222509 predicted 1378
6 SASI_Mm01_00222510 predicted 485
7 SASI_Mm01_00222511 predicted 897
8 SASI_Mm01_00222512 predicted 1394
9 SASI_Mm01_00222513 predicted 234
10 SASI_Mm01_00222514 predicted 412
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021147
CCNO MISSION shRNA Bacterial Glycerol Stock
cyclin O
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021147.1-670s1c1
Sequence:CCGGCTTCCTGACATTTCAGCACCTCTCGAGAGGTGCTGAAATGTCAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021147.1-214s1c1
Sequence:CCGGCGTTTCTCTTTCTGAACTCTTCTCGAGAAGAGTTCAGAAAGAGAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021147.1-661s1c1
Sequence:CCGGCATTAGCTTCTTCCTGACATTCTCGAGAATGTCAGGAAGAAGCTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160535    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021147.1-209s1c1
Sequence:CCGGCATTGCGTTTCTCTTTCTGAACTCGAGTTCAGAAAGAGAAACGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021147.1-197s1c1
Sequence:CCGGGTTTCCAGTTTCCATTGCGTTCTCGAGAACGCAATGGAAACTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021147.1-261s1c1
Sequence:CCGGGATTCTTCTTGGCCCTTCCTTCTCGAGAAGGAAGGGCCAAGAAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021147.1-932s1c1
Sequence:CCGGCAGTACTTCCTTGACTCACATCTCGAGATGTGAGTCAAGGAAGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021147.1-660s1c1
Sequence:CCGGCCATTAGCTTCTTCCTGACATCTCGAGATGTCAGGAAGAAGCTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021147
CCNO MISSION shRNA shRNA Plasmid DNA
cyclin O
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021147.1-670s1c1
Sequence:CCGGCTTCCTGACATTTCAGCACCTCTCGAGAGGTGCTGAAATGTCAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021147.1-214s1c1
Sequence:CCGGCGTTTCTCTTTCTGAACTCTTCTCGAGAAGAGTTCAGAAAGAGAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021147.1-661s1c1
Sequence:CCGGCATTAGCTTCTTCCTGACATTCTCGAGAATGTCAGGAAGAAGCTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160535    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021147.1-209s1c1
Sequence:CCGGCATTGCGTTTCTCTTTCTGAACTCGAGTTCAGAAAGAGAAACGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021147.1-197s1c1
Sequence:CCGGGTTTCCAGTTTCCATTGCGTTCTCGAGAACGCAATGGAAACTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021147.1-261s1c1
Sequence:CCGGGATTCTTCTTGGCCCTTCCTTCTCGAGAAGGAAGGGCCAAGAAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021147.1-932s1c1
Sequence:CCGGCAGTACTTCCTTGACTCACATCTCGAGATGTGAGTCAAGGAAGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021147.1-660s1c1
Sequence:CCGGCCATTAGCTTCTTCCTGACATCTCGAGATGTCAGGAAGAAGCTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021147
CCNO MISSION shRNA Lentiviral Transduction Particles
cyclin O
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021147.1-670s1c1
Sequence:CCGGCTTCCTGACATTTCAGCACCTCTCGAGAGGTGCTGAAATGTCAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021147.1-214s1c1
Sequence:CCGGCGTTTCTCTTTCTGAACTCTTCTCGAGAAGAGTTCAGAAAGAGAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021147.1-661s1c1
Sequence:CCGGCATTAGCTTCTTCCTGACATTCTCGAGAATGTCAGGAAGAAGCTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160535    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021147.1-209s1c1
Sequence:CCGGCATTGCGTTTCTCTTTCTGAACTCGAGTTCAGAAAGAGAAACGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021147.1-197s1c1
Sequence:CCGGGTTTCCAGTTTCCATTGCGTTCTCGAGAACGCAATGGAAACTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021147.1-261s1c1
Sequence:CCGGGATTCTTCTTGGCCCTTCCTTCTCGAGAAGGAAGGGCCAAGAAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021147.1-932s1c1
Sequence:CCGGCAGTACTTCCTTGACTCACATCTCGAGATGTGAGTCAAGGAAGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021147.1-660s1c1
Sequence:CCGGCCATTAGCTTCTTCCTGACATCTCGAGATGTCAGGAAGAAGCTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_127523
CCNO MISSION shRNA Bacterial Glycerol Stock
cyclin O
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087918    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_127523.3-1195s1c1
Sequence:CCGGGCAGTACAGATCCAAAGAGAACTCGAGTTCTCTTTGGATCTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127523.3-358s1c1
Sequence:CCGGTCTCCAGACCTTCCGAGAATACTCGAGTATTCTCGGAAGGTCTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127523.3-460s1c1
Sequence:CCGGGACTGCCGAATCGCGCTGTAACTCGAGTTACAGCGCGATTCGGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127523.3-1037s1c1
Sequence:CCGGCAGACGCTAGTGTCCATCAATCTCGAGATTGATGGACACTAGCGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127523.3-547s1c1
Sequence:CCGGCGTGAATACTCTGGACCGTTTCTCGAGAAACGGTCCAGAGTATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_127523
CCNO MISSION shRNA shRNA Plasmid DNA
cyclin O
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087918    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_127523.3-1195s1c1
Sequence:CCGGGCAGTACAGATCCAAAGAGAACTCGAGTTCTCTTTGGATCTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127523.3-358s1c1
Sequence:CCGGTCTCCAGACCTTCCGAGAATACTCGAGTATTCTCGGAAGGTCTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127523.3-460s1c1
Sequence:CCGGGACTGCCGAATCGCGCTGTAACTCGAGTTACAGCGCGATTCGGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127523.3-1037s1c1
Sequence:CCGGCAGACGCTAGTGTCCATCAATCTCGAGATTGATGGACACTAGCGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127523.3-547s1c1
Sequence:CCGGCGTGAATACTCTGGACCGTTTCTCGAGAAACGGTCCAGAGTATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_127523
CCNO MISSION shRNA Lentiviral Transduction Particles
cyclin O
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087918    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_127523.3-1195s1c1
Sequence:CCGGGCAGTACAGATCCAAAGAGAACTCGAGTTCTCTTTGGATCTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127523.3-358s1c1
Sequence:CCGGTCTCCAGACCTTCCGAGAATACTCGAGTATTCTCGGAAGGTCTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127523.3-460s1c1
Sequence:CCGGGACTGCCGAATCGCGCTGTAACTCGAGTTACAGCGCGATTCGGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127523.3-1037s1c1
Sequence:CCGGCAGACGCTAGTGTCCATCAATCTCGAGATTGATGGACACTAGCGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127523.3-547s1c1
Sequence:CCGGCGTGAATACTCTGGACCGTTTCTCGAGAAACGGTCCAGAGTATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks