EMAIL THIS PAGE TO A FRIEND

CCNT1

cyclin T1

49 Gene Product Result for
Synonyms: CCNT CYCT1 HIVE1
UniProtKB ID: O60563, O60581
Gene ID:
Human(904) Summary: This gene encodes a member of the highly conserved cyclin C subfamily. The encoded protein tightly associates with cyclin-dependent kinase 9, and is a major subunit of positive transcription elongation factor b (p-TEFb). In humans, there are multiple forms of positive transcription elongation factor b, which may include one of several different cyclins along with cyclin-dependent kinase 9. The complex containing the encoded cyclin and cyclin-dependent kinase 9 acts as a cofactor of human immunodeficiency virus type 1 (HIV-1) Tat protein, and is both necessary and sufficient for full activation of viral transcription. This cyclin and its kinase partner are also involved in triggering transcript elongation through phosphorylation of the carboxy-terminal domain of the largest RNA polymerase II subunit. Overexpression of this gene is implicated in tumor growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013]
Mouse(12455) cyclin T1
Rat(315291) cyclin T1
Zebrafish(334465) cyclin T1
cow(407194) cyclin T1
Horse(100033893) cyclin T1
dog(486564) cyclin T1
chicken(100859215) cyclin T1
Goat(100860835) cyclin T1
sheep(101106415) cyclin T1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1405574 Anti-CCNT1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA004892 Anti-CCNT1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB2100367 Anti-CCNT1 antibody produced in rabbit affinity isolated antibody pig, guinea pig, horse, canine, human, zebrafish, rabbit, bovine, mouse, rat
western blot pricing
SAB3501029 Anti-CCNT1 antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
PLA0282 Rabbit anti-Cyclin T1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. rhesus monkey, gorilla, human, gibbon, primate, chimpanzee
immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009833 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009833 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009833 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001240 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001240 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001240 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001240 Rosetta Predictions human pricing
NM_001108110 Rosetta Predictions rat pricing
NM_009833 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001240 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232112 predicted 468
2 SASI_Hs01_00232113 predicted 1381
3 SASI_Hs01_00232115 predicted 919
4 SASI_Hs01_00232116 predicted 818
5 SASI_Hs01_00232117 predicted 793
6 SASI_Hs01_00232118 predicted 631
7 SASI_Hs01_00232119 predicted 355
8 SASI_Hs01_00232120 predicted 1577
9 SASI_Hs01_00232121 predicted 678
10 SASI_Hs02_00331412 predicted 1161
11 SASI_Hs01_00232114 predicted 1976
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108110 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235454 predicted 520
2 SASI_Rn02_00235455 predicted 882
3 SASI_Rn02_00235456 predicted 1759
4 SASI_Rn02_00235457 predicted 687
5 SASI_Rn02_00235458 predicted 374
6 SASI_Rn02_00235459 predicted 969
7 SASI_Rn02_00235460 predicted 1067
8 SASI_Rn02_00235461 predicted 892
9 SASI_Rn02_00235462 predicted 523
10 SASI_Rn02_00235463 predicted 1091
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009833 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057651 predicted 949
2 SASI_Mm02_00317183 predicted 682
3 SASI_Mm01_00057652 predicted 1425
4 SASI_Mm01_00057653 predicted 890
5 SASI_Mm01_00057655 predicted 869
6 SASI_Mm01_00057656 predicted 1071
7 SASI_Mm01_00057657 predicted 698
8 SASI_Mm01_00057658 predicted 895
9 SASI_Mm01_00057659 predicted 743
10 SASI_Mm01_00057660 predicted 1183
11 SASI_Mm01_00057654 predicted 1443
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009833
VALIDATED
CCNT1 MISSION shRNA Bacterial Glycerol Stock
cyclin T1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009833.1-902s1c1
Sequence:CCGGGCATGTCAACTGCGTCTACAACTCGAGTTGTAGACGCAGTTGACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009833.1-1005s1c1
Sequence:CCGGGTCTTCCCAACCTCCGTTTAACTCGAGTTAAACGGAGGTTGGGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009833.1-173s1c1
Sequence:CCGGCGATCAATACTGCTATAGTATCTCGAGATACTATAGCAGTATTGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009833.1-1944s1c1
Sequence:CCGGCGCAACTCAGTCAATAGATTACTCGAGTAATCTATTGACTGAGTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009833.1-542s21c1
Sequence:CCGGGCCTGCATTTGACCACATTTACTCGAGTAAATGTGGTCAAATGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009833.1-1432s21c1
Sequence:CCGGGAGATAAAGATGCGCATTAAACTCGAGTTTAATGCGCATCTTTATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009833.1-1939s1c2
Sequence:CCGGCACAACGCAACTCAGTCAATACTCGAGTATTGACTGAGTTGCGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009833.1-1939s21c1
Sequence:CCGGCACAACGCAACTCAGTCAATACTCGAGTATTGACTGAGTTGCGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009833.1-879s21c1
Sequence:CCGGCACAACTATCGCAGGATTAATCTCGAGATTAATCCTGCGATAGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009833.1-430s21c1
Sequence:CCGGTTAGGGTTTGAACTAACAATTCTCGAGAATTGTTAGTTCAAACCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009833.1-1766s21c1
Sequence:CCGGAGATTGCCAAGAGTACTAAATCTCGAGATTTAGTACTCTTGGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009833.1-80s21c1
Sequence:CCGGTTGGCGTGGACTCCGATAAAGCTCGAGCTTTATCGGAGTCCACGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009833
VALIDATED
CCNT1 MISSION shRNA shRNA Plasmid DNA
cyclin T1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009833.1-902s1c1
Sequence:CCGGGCATGTCAACTGCGTCTACAACTCGAGTTGTAGACGCAGTTGACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009833.1-1005s1c1
Sequence:CCGGGTCTTCCCAACCTCCGTTTAACTCGAGTTAAACGGAGGTTGGGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009833.1-173s1c1
Sequence:CCGGCGATCAATACTGCTATAGTATCTCGAGATACTATAGCAGTATTGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009833.1-1944s1c1
Sequence:CCGGCGCAACTCAGTCAATAGATTACTCGAGTAATCTATTGACTGAGTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009833.1-542s21c1
Sequence:CCGGGCCTGCATTTGACCACATTTACTCGAGTAAATGTGGTCAAATGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009833.1-1432s21c1
Sequence:CCGGGAGATAAAGATGCGCATTAAACTCGAGTTTAATGCGCATCTTTATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009833.1-1939s1c2
Sequence:CCGGCACAACGCAACTCAGTCAATACTCGAGTATTGACTGAGTTGCGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009833.1-1939s21c1
Sequence:CCGGCACAACGCAACTCAGTCAATACTCGAGTATTGACTGAGTTGCGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009833.1-879s21c1
Sequence:CCGGCACAACTATCGCAGGATTAATCTCGAGATTAATCCTGCGATAGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009833.1-430s21c1
Sequence:CCGGTTAGGGTTTGAACTAACAATTCTCGAGAATTGTTAGTTCAAACCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009833.1-1766s21c1
Sequence:CCGGAGATTGCCAAGAGTACTAAATCTCGAGATTTAGTACTCTTGGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009833.1-80s21c1
Sequence:CCGGTTGGCGTGGACTCCGATAAAGCTCGAGCTTTATCGGAGTCCACGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009833
VALIDATED
CCNT1 MISSION shRNA Lentiviral Transduction Particles
cyclin T1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009833.1-902s1c1
Sequence:CCGGGCATGTCAACTGCGTCTACAACTCGAGTTGTAGACGCAGTTGACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009833.1-1005s1c1
Sequence:CCGGGTCTTCCCAACCTCCGTTTAACTCGAGTTAAACGGAGGTTGGGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009833.1-173s1c1
Sequence:CCGGCGATCAATACTGCTATAGTATCTCGAGATACTATAGCAGTATTGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009833.1-1944s1c1
Sequence:CCGGCGCAACTCAGTCAATAGATTACTCGAGTAATCTATTGACTGAGTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009833.1-542s21c1
Sequence:CCGGGCCTGCATTTGACCACATTTACTCGAGTAAATGTGGTCAAATGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009833.1-1432s21c1
Sequence:CCGGGAGATAAAGATGCGCATTAAACTCGAGTTTAATGCGCATCTTTATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009833.1-1939s1c2
Sequence:CCGGCACAACGCAACTCAGTCAATACTCGAGTATTGACTGAGTTGCGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009833.1-1939s21c1
Sequence:CCGGCACAACGCAACTCAGTCAATACTCGAGTATTGACTGAGTTGCGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009833.1-879s21c1
Sequence:CCGGCACAACTATCGCAGGATTAATCTCGAGATTAATCCTGCGATAGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009833.1-430s21c1
Sequence:CCGGTTAGGGTTTGAACTAACAATTCTCGAGAATTGTTAGTTCAAACCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009833.1-1766s21c1
Sequence:CCGGAGATTGCCAAGAGTACTAAATCTCGAGATTTAGTACTCTTGGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009833.1-80s21c1
Sequence:CCGGTTGGCGTGGACTCCGATAAAGCTCGAGCTTTATCGGAGTCCACGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001240
VALIDATED
CCNT1 MISSION shRNA Bacterial Glycerol Stock
cyclin T1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001240.2-582s1c1
Sequence:CCGGGCCTTGTTTCTAGCAGCTAAACTCGAGTTTAGCTGCTAGAAACAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001240.2-1557s1c1
Sequence:CCGGGCCAATGTGAAGTCACAATATCTCGAGATATTGTGACTTCACATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001240.2-354s1c1
Sequence:CCGGCGGTGGTATTTCACTCGAGAACTCGAGTTCTCGAGTGAAATACCACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001240.2-865s1c1
Sequence:CCGGGCCTGCATTTGACCACATTTACTCGAGTAAATGTGGTCAAATGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001240.2-2355s1c1
Sequence:CCGGCCCACTGCATTTGAATTTGTTCTCGAGAACAAATTCAAATGCAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001240.2-753s21c1
Sequence:CCGGTTAGGCTTTGAACTAACAATTCTCGAGAATTGTTAGTTCAAAGCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001240.2-2092s21c1
Sequence:CCGGAGATTGCCAAGAGTACTAAATCTCGAGATTTAGTACTCTTGGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001240.2-1557s21c1
Sequence:CCGGGCCAATGTGAAGTCACAATATCTCGAGATATTGTGACTTCACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001240.2-683s21c1
Sequence:CCGGTACTAGAAGTGAGGCTTATTTCTCGAGAAATAAGCCTCACTTCTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001240.2-865s21c1
Sequence:CCGGGCCTGCATTTGACCACATTTACTCGAGTAAATGTGGTCAAATGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001240
VALIDATED
CCNT1 MISSION shRNA shRNA Plasmid DNA
cyclin T1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001240.2-582s1c1
Sequence:CCGGGCCTTGTTTCTAGCAGCTAAACTCGAGTTTAGCTGCTAGAAACAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001240.2-1557s1c1
Sequence:CCGGGCCAATGTGAAGTCACAATATCTCGAGATATTGTGACTTCACATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001240.2-354s1c1
Sequence:CCGGCGGTGGTATTTCACTCGAGAACTCGAGTTCTCGAGTGAAATACCACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001240.2-865s1c1
Sequence:CCGGGCCTGCATTTGACCACATTTACTCGAGTAAATGTGGTCAAATGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001240.2-2355s1c1
Sequence:CCGGCCCACTGCATTTGAATTTGTTCTCGAGAACAAATTCAAATGCAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001240.2-753s21c1
Sequence:CCGGTTAGGCTTTGAACTAACAATTCTCGAGAATTGTTAGTTCAAAGCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001240.2-2092s21c1
Sequence:CCGGAGATTGCCAAGAGTACTAAATCTCGAGATTTAGTACTCTTGGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001240.2-1557s21c1
Sequence:CCGGGCCAATGTGAAGTCACAATATCTCGAGATATTGTGACTTCACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001240.2-683s21c1
Sequence:CCGGTACTAGAAGTGAGGCTTATTTCTCGAGAAATAAGCCTCACTTCTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001240.2-865s21c1
Sequence:CCGGGCCTGCATTTGACCACATTTACTCGAGTAAATGTGGTCAAATGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001240
VALIDATED
CCNT1 MISSION shRNA Lentiviral Transduction Particles
cyclin T1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001240.2-582s1c1
Sequence:CCGGGCCTTGTTTCTAGCAGCTAAACTCGAGTTTAGCTGCTAGAAACAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001240.2-1557s1c1
Sequence:CCGGGCCAATGTGAAGTCACAATATCTCGAGATATTGTGACTTCACATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001240.2-354s1c1
Sequence:CCGGCGGTGGTATTTCACTCGAGAACTCGAGTTCTCGAGTGAAATACCACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001240.2-865s1c1
Sequence:CCGGGCCTGCATTTGACCACATTTACTCGAGTAAATGTGGTCAAATGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001240.2-2355s1c1
Sequence:CCGGCCCACTGCATTTGAATTTGTTCTCGAGAACAAATTCAAATGCAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001240.2-753s21c1
Sequence:CCGGTTAGGCTTTGAACTAACAATTCTCGAGAATTGTTAGTTCAAAGCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001240.2-2092s21c1
Sequence:CCGGAGATTGCCAAGAGTACTAAATCTCGAGATTTAGTACTCTTGGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001240.2-1557s21c1
Sequence:CCGGGCCAATGTGAAGTCACAATATCTCGAGATATTGTGACTTCACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001240.2-683s21c1
Sequence:CCGGTACTAGAAGTGAGGCTTATTTCTCGAGAAATAAGCCTCACTTCTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001240.2-865s21c1
Sequence:CCGGGCCTGCATTTGACCACATTTACTCGAGTAAATGTGGTCAAATGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks