EMAIL THIS PAGE TO A FRIEND

CCNT2

cyclin T2

Synonyms: CYCT2
Gene ID:
Human(905) Summary: The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin and its kinase partner CDK9 were found to be subunits of the transcription elongation factor p-TEFb. The p-TEFb complex containing this cyclin was reported to interact with, and act as a negative regulator of human immunodeficiency virus type 1 (HIV-1) Tat protein. A pseudogene of this gene is found on chromosome 1. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Dec 2010]
Mouse(72949) cyclin T2
Rat(304758) cyclin T2
sheep(101106913) cyclin T2
chicken(424289) cyclin T2
cow(521089) cyclin T2
Horse(100050510) cyclin T2
dog(476126) cyclin T2
251 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001241 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001241 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001241 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028399 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028399 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028399 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001241 Rosetta Predictions human pricing
NM_058241 Rosetta Predictions human pricing
NM_001107171 Rosetta Predictions rat pricing
NM_028399 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001241 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151759 predicted 1675
2 SASI_Hs02_00331413 predicted 508
3 SASI_Hs02_00331414 predicted 624
4 SASI_Hs01_00151761 predicted 1550
5 SASI_Hs01_00151762 predicted 406
6 SASI_Hs02_00331415 predicted 423
7 SASI_Hs02_00331416 predicted 424
8 SASI_Hs01_00151767 predicted 1460
9 SASI_Hs02_00331417 predicted 735
10 SASI_Hs01_00151768 predicted 1539
11 SASI_Hs01_00151760 predicted 1049
12 SASI_Hs01_00151763 predicted 1264
13 SASI_Hs01_00151764 predicted 1140
14 SASI_Hs01_00151765 predicted 1010
15 SASI_Hs01_00151766 predicted 1285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058241 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055122 predicted 1678
2 SASI_Hs01_00055123 predicted 1041
3 SASI_Hs02_00362146 predicted 624
4 SASI_Hs01_00055124 predicted 1558
5 SASI_Hs01_00055125 predicted 410
6 SASI_Hs02_00362147 predicted 1004
7 SASI_Hs01_00055128 predicted 1271
8 SASI_Hs01_00055129 predicted 1459
9 SASI_Hs01_00055130 predicted 736
10 SASI_Hs01_00055131 predicted 1546
11 SASI_Hs01_00055126 predicted 1268
12 SASI_Hs01_00055127 predicted 1135
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107171 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226205 predicted 2181
2 SASI_Rn02_00226206 predicted 2170
3 SASI_Rn02_00226207 predicted 624
4 SASI_Rn02_00226208 predicted 1501
5 SASI_Rn02_00226209 predicted 738
6 SASI_Rn02_00226210 predicted 651
7 SASI_Rn02_00226211 predicted 472
8 SASI_Rn02_00226212 predicted 979
9 SASI_Rn02_00226213 predicted 693
10 SASI_Rn02_00226214 predicted 680
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028399 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092446 predicted 285
2 SASI_Mm01_00092447 predicted 1268
3 SASI_Mm01_00092448 predicted 2201
4 SASI_Mm01_00092449 predicted 660
5 SASI_Mm01_00092450 predicted 677
6 SASI_Mm01_00092451 predicted 989
7 SASI_Mm01_00092452 predicted 1997
8 SASI_Mm01_00092453 predicted 1241
9 SASI_Mm02_00333801 predicted 597
10 SASI_Mm01_00092454 predicted 2223
11 SASI_Mm01_00092455 predicted 1640
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001241
VALIDATED
CCNT2 MISSION shRNA Bacterial Glycerol Stock
cyclin T2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000418571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001241.2-1283s21c1
Sequence:CCGGTAAACACCATGGGCCAATTTCCTCGAGGAAATTGGCCCATGGTGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001241.2-276s21c1
Sequence:CCGGATATCGTCTACTGCATTATTTCTCGAGAAATAATGCAGTAGACGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001241.2-535s21c1
Sequence:CCGGATTTGGCACAGACATCCTATTCTCGAGAATAGGATGTCTGTGCCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001241.2-2653s1c1
Sequence:CCGGGCTGCTTGTAAGTATAACAATCTCGAGATTGTTATACTTACAAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_001241.2-1311s1c1
Sequence:CCGGCCAGGAATAATTCCTCAGAAACTCGAGTTTCTGAGGAATTATTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_001241.2-242s1c1
Sequence:CCGGGCACCATTCTTTCACCAAATTCTCGAGAATTTGGTGAAAGAATGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001241.2-512s1c1
Sequence:CCGGCCAGTTAGTAAGAGCAAGCAACTCGAGTTGCTTGCTCTTACTAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000454946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001241.2-793s21c1
Sequence:CCGGTTCGAAACTGGAGGGCTAATCCTCGAGGATTAGCCCTCCAGTTTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001241
VALIDATED
CCNT2 MISSION shRNA shRNA Plasmid DNA
cyclin T2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000418571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001241.2-1283s21c1
Sequence:CCGGTAAACACCATGGGCCAATTTCCTCGAGGAAATTGGCCCATGGTGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001241.2-276s21c1
Sequence:CCGGATATCGTCTACTGCATTATTTCTCGAGAAATAATGCAGTAGACGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001241.2-535s21c1
Sequence:CCGGATTTGGCACAGACATCCTATTCTCGAGAATAGGATGTCTGTGCCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001241.2-2653s1c1
Sequence:CCGGGCTGCTTGTAAGTATAACAATCTCGAGATTGTTATACTTACAAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_001241.2-1311s1c1
Sequence:CCGGCCAGGAATAATTCCTCAGAAACTCGAGTTTCTGAGGAATTATTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_001241.2-242s1c1
Sequence:CCGGGCACCATTCTTTCACCAAATTCTCGAGAATTTGGTGAAAGAATGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001241.2-512s1c1
Sequence:CCGGCCAGTTAGTAAGAGCAAGCAACTCGAGTTGCTTGCTCTTACTAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000454946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001241.2-793s21c1
Sequence:CCGGTTCGAAACTGGAGGGCTAATCCTCGAGGATTAGCCCTCCAGTTTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001241
VALIDATED
CCNT2 MISSION shRNA Lentiviral Transduction Particles
cyclin T2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000418571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001241.2-1283s21c1
Sequence:CCGGTAAACACCATGGGCCAATTTCCTCGAGGAAATTGGCCCATGGTGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001241.2-276s21c1
Sequence:CCGGATATCGTCTACTGCATTATTTCTCGAGAAATAATGCAGTAGACGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001241.2-535s21c1
Sequence:CCGGATTTGGCACAGACATCCTATTCTCGAGAATAGGATGTCTGTGCCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001241.2-2653s1c1
Sequence:CCGGGCTGCTTGTAAGTATAACAATCTCGAGATTGTTATACTTACAAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_001241.2-1311s1c1
Sequence:CCGGCCAGGAATAATTCCTCAGAAACTCGAGTTTCTGAGGAATTATTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_001241.2-242s1c1
Sequence:CCGGGCACCATTCTTTCACCAAATTCTCGAGAATTTGGTGAAAGAATGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001241.2-512s1c1
Sequence:CCGGCCAGTTAGTAAGAGCAAGCAACTCGAGTTGCTTGCTCTTACTAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000454946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001241.2-793s21c1
Sequence:CCGGTTCGAAACTGGAGGGCTAATCCTCGAGGATTAGCCCTCCAGTTTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028399
CCNT2 MISSION shRNA Bacterial Glycerol Stock
cyclin T2
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028399.1-986s21c1
Sequence:CCGGCCTGCTCCAATACCTCTAAATCTCGAGATTTAGAGGTATTGGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028399.1-3059s21c1
Sequence:CCGGCTGTAGAAAGCAGCTAATAATCTCGAGATTATTAGCTGCTTTCTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028399.1-618s1c1
Sequence:CCGGCCTTCTGTCTTCAGTACAAACCTCGAGGTTTGTACTGAAGACAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217729    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028399.1-274s1c1
Sequence:CCGGGCACCATTCCTTCACCAAATTCTCGAGAATTTGGTGAAGGAATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028399.1-1031s21c1
Sequence:CCGGAGCCGTGCATCTGATAATTTACTCGAGTAAATTATCAGATGCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028399.1-355s21c1
Sequence:CCGGTCGAAAGCTTGAACATGTTATCTCGAGATAACATGTTCAAGCTTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176169    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028399.1-2441s1c1
Sequence:CCGGGCTGAGAACATTAGGATGAATCTCGAGATTCATCCTAATGTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028399.1-1774s1c1
Sequence:CCGGCAGCCACAAGTATTTGCACATCTCGAGATGTGCAAATACTTGTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028399.1-806s1c1
Sequence:CCGGCCTAGTAGGTTGAAGAGGATTCTCGAGAATCCTCTTCAACCTACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028399.1-2092s1c1
Sequence:CCGGCCTCGTGAAACTGGACAAGAACTCGAGTTCTTGTCCAGTTTCACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194329    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028399.1-3118s1c1
Sequence:CCGGCCAGTGAAGATGAGTCCATTTCTCGAGAAATGGACTCATCTTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193601    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028399.1-2722s1c1
Sequence:CCGGGCTGCTTGTAAGAATAACAATCTCGAGATTGTTATTCTTACAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028399.1-1245s1c1
Sequence:CCGGCGGACAAAGTTGCTGATCATTCTCGAGAATGATCAGCAACTTTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028399
CCNT2 MISSION shRNA shRNA Plasmid DNA
cyclin T2
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028399.1-986s21c1
Sequence:CCGGCCTGCTCCAATACCTCTAAATCTCGAGATTTAGAGGTATTGGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028399.1-3059s21c1
Sequence:CCGGCTGTAGAAAGCAGCTAATAATCTCGAGATTATTAGCTGCTTTCTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028399.1-618s1c1
Sequence:CCGGCCTTCTGTCTTCAGTACAAACCTCGAGGTTTGTACTGAAGACAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217729    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028399.1-274s1c1
Sequence:CCGGGCACCATTCCTTCACCAAATTCTCGAGAATTTGGTGAAGGAATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028399.1-1031s21c1
Sequence:CCGGAGCCGTGCATCTGATAATTTACTCGAGTAAATTATCAGATGCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028399.1-355s21c1
Sequence:CCGGTCGAAAGCTTGAACATGTTATCTCGAGATAACATGTTCAAGCTTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176169    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028399.1-2441s1c1
Sequence:CCGGGCTGAGAACATTAGGATGAATCTCGAGATTCATCCTAATGTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028399.1-1774s1c1
Sequence:CCGGCAGCCACAAGTATTTGCACATCTCGAGATGTGCAAATACTTGTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028399.1-806s1c1
Sequence:CCGGCCTAGTAGGTTGAAGAGGATTCTCGAGAATCCTCTTCAACCTACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028399.1-2092s1c1
Sequence:CCGGCCTCGTGAAACTGGACAAGAACTCGAGTTCTTGTCCAGTTTCACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194329    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028399.1-3118s1c1
Sequence:CCGGCCAGTGAAGATGAGTCCATTTCTCGAGAAATGGACTCATCTTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193601    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028399.1-2722s1c1
Sequence:CCGGGCTGCTTGTAAGAATAACAATCTCGAGATTGTTATTCTTACAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028399.1-1245s1c1
Sequence:CCGGCGGACAAAGTTGCTGATCATTCTCGAGAATGATCAGCAACTTTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028399
CCNT2 MISSION shRNA Lentiviral Transduction Particles
cyclin T2
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028399.1-986s21c1
Sequence:CCGGCCTGCTCCAATACCTCTAAATCTCGAGATTTAGAGGTATTGGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028399.1-3059s21c1
Sequence:CCGGCTGTAGAAAGCAGCTAATAATCTCGAGATTATTAGCTGCTTTCTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028399.1-618s1c1
Sequence:CCGGCCTTCTGTCTTCAGTACAAACCTCGAGGTTTGTACTGAAGACAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217729    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028399.1-274s1c1
Sequence:CCGGGCACCATTCCTTCACCAAATTCTCGAGAATTTGGTGAAGGAATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028399.1-1031s21c1
Sequence:CCGGAGCCGTGCATCTGATAATTTACTCGAGTAAATTATCAGATGCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028399.1-355s21c1
Sequence:CCGGTCGAAAGCTTGAACATGTTATCTCGAGATAACATGTTCAAGCTTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176169    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028399.1-2441s1c1
Sequence:CCGGGCTGAGAACATTAGGATGAATCTCGAGATTCATCCTAATGTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028399.1-1774s1c1
Sequence:CCGGCAGCCACAAGTATTTGCACATCTCGAGATGTGCAAATACTTGTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028399.1-806s1c1
Sequence:CCGGCCTAGTAGGTTGAAGAGGATTCTCGAGAATCCTCTTCAACCTACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028399.1-2092s1c1
Sequence:CCGGCCTCGTGAAACTGGACAAGAACTCGAGTTCTTGTCCAGTTTCACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194329    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028399.1-3118s1c1
Sequence:CCGGCCAGTGAAGATGAGTCCATTTCTCGAGAAATGGACTCATCTTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193601    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028399.1-2722s1c1
Sequence:CCGGGCTGCTTGTAAGAATAACAATCTCGAGATTGTTATTCTTACAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028399.1-1245s1c1
Sequence:CCGGCGGACAAAGTTGCTGATCATTCTCGAGAATGATCAGCAACTTTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks