EMAIL THIS PAGE TO A FRIEND

CCNY

cyclin Y

119 Gene Product Result for
Synonyms: C10orf9 CBCP1 CCNX CFP1
Gene ID:
Human(219771) Summary: Cyclins, such as CCNY, control cell division cycles and regulate cyclin-dependent kinases (e.g., CDC2; MIM 116940) (Li et al., 2009 [PubMed 18060517]
Mouse(67974) cyclin Y
Rat(361261) cyclin Y
cow(613711) cyclin Y
dog(606967) cyclin Y
chicken(428412) cyclin Y
Goat(100861154) cyclin Y
sheep(101122455) cyclin Y
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100368 Anti-CCNY antibody produced in rabbit affinity isolated antibody horse, guinea pig, rabbit, bovine, mouse, rat, human
western blot pricing
HPA036290 Anti-CCNY antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145012 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145012 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145012 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026484 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026484 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026484 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU060551 MISSION® esiRNA esiRNA human CCNY (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145012 Rosetta Predictions human pricing
NM_181698 Rosetta Predictions human pricing
XM_001065252 Rosetta Predictions rat pricing
XM_341545 Rosetta Predictions rat pricing
NM_026484 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145012 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199444 predicted 304
2 SASI_Hs01_00199445 predicted 197
3 SASI_Hs01_00199446 predicted 231
4 SASI_Hs01_00199447 predicted 235
5 SASI_Hs01_00199448 predicted 1462
6 SASI_Hs01_00199449 predicted 371
7 SASI_Hs01_00199450 predicted 793
8 SASI_Hs02_00364859 predicted 277
9 SASI_Hs02_00364860 predicted 757
10 SASI_Hs01_00199451 predicted 293
11 SASI_Hs01_00199452 predicted 413
12 SASI_Hs01_00199453 predicted 382
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181698 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370297 predicted 523
2 SASI_Hs01_00154001 predicted 904
3 SASI_Hs01_00154002 predicted 906
4 SASI_Hs01_00154003 predicted 669
5 SASI_Hs01_00154004 predicted 653
6 SASI_Hs01_00154005 predicted 557
7 SASI_Hs01_00154006 predicted 954
8 SASI_Hs01_00154007 predicted 920
9 SASI_Hs01_00154008 predicted 500
10 SASI_Hs01_00154009 predicted 698
11 SASI_Hs01_00154010 predicted 503
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065252 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00313418 predicted 770
2 SASI_Rn02_00313419 predicted 604
3 SASI_Rn02_00313420 predicted 766
4 SASI_Rn02_00313421 predicted 360
5 SASI_Rn02_00313422 predicted 244
6 SASI_Rn02_00313423 predicted 730
7 SASI_Rn02_00313424 predicted 594
8 SASI_Rn02_00313425 predicted 586
9 SASI_Rn02_00313426 predicted 667
10 SASI_Rn02_00313427 predicted 585
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341545 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393062 predicted 769
2 SASI_Rn02_00393063 predicted 601
3 SASI_Rn02_00393064 predicted 770
4 SASI_Rn02_00393065 predicted 362
5 SASI_Rn02_00393066 predicted 244
6 SASI_Rn02_00393067 predicted 724
7 SASI_Rn02_00393068 predicted 598
8 SASI_Rn02_00393069 predicted 587
9 SASI_Rn02_00393070 predicted 665
10 SASI_Rn02_00393071 predicted 586
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026484 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184590 predicted 671
2 SASI_Mm01_00184591 predicted 1041
3 SASI_Mm01_00184592 predicted 852
4 SASI_Mm01_00184593 predicted 1078
5 SASI_Mm01_00184594 predicted 886
6 SASI_Mm01_00184595 predicted 966
7 SASI_Mm01_00184596 predicted 783
8 SASI_Mm01_00184597 predicted 1243
9 SASI_Mm01_00184598 predicted 1146
10 SASI_Mm01_00184599 predicted 1130
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145012
VALIDATED
CCNY MISSION shRNA Bacterial Glycerol Stock
cyclin Y
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000180328    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145012.3-1645s1c1
Sequence:CCGGCGCTGTCTTCTGAGCTTTCTTCTCGAGAAGAAAGCTCAGAAGACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148204    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_145012.3-1591s1c1
Sequence:CCGGGCGCAGACTTCCAAATAAATACTCGAGTATTTATTTGGAAGTCTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_145012.3-310s1c1
Sequence:CCGGCAGGACAAATAGCAAGGAAATCTCGAGATTTCCTTGCTATTTGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_145012.3-373s1c1
Sequence:CCGGGTCAACCAAACCTCAAGTATACTCGAGTATACTTGAGGTTTGGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145012
VALIDATED
CCNY MISSION shRNA shRNA Plasmid DNA
cyclin Y
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000180328    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145012.3-1645s1c1
Sequence:CCGGCGCTGTCTTCTGAGCTTTCTTCTCGAGAAGAAAGCTCAGAAGACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148204    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_145012.3-1591s1c1
Sequence:CCGGGCGCAGACTTCCAAATAAATACTCGAGTATTTATTTGGAAGTCTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_145012.3-310s1c1
Sequence:CCGGCAGGACAAATAGCAAGGAAATCTCGAGATTTCCTTGCTATTTGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_145012.3-373s1c1
Sequence:CCGGGTCAACCAAACCTCAAGTATACTCGAGTATACTTGAGGTTTGGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145012
VALIDATED
CCNY MISSION shRNA Lentiviral Transduction Particles
cyclin Y
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000180328    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145012.3-1645s1c1
Sequence:CCGGCGCTGTCTTCTGAGCTTTCTTCTCGAGAAGAAAGCTCAGAAGACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148204    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_145012.3-1591s1c1
Sequence:CCGGGCGCAGACTTCCAAATAAATACTCGAGTATTTATTTGGAAGTCTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_145012.3-310s1c1
Sequence:CCGGCAGGACAAATAGCAAGGAAATCTCGAGATTTCCTTGCTATTTGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_145012.3-373s1c1
Sequence:CCGGGTCAACCAAACCTCAAGTATACTCGAGTATACTTGAGGTTTGGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026484
VALIDATED
CCNY MISSION shRNA Bacterial Glycerol Stock
cyclin Y
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106080    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026484.2-3466s1c1
Sequence:CCGGGCCAAATATGAATGCCTCTTACTCGAGTAAGAGGCATTCATATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026484.2-856s1c1
Sequence:CCGGGCGATATATTACCACATCAAACTCGAGTTTGATGTGGTAATATATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026484.2-1075s1c1
Sequence:CCGGCTCTTGACATACGCAGAGATTCTCGAGAATCTCTGCGTATGTCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026484.2-1108s1c1
Sequence:CCGGGCCAATTGGAAGCGCATTGTTCTCGAGAACAATGCGCTTCCAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026484.2-630s1c1
Sequence:CCGGCGACGATTTAAACATGGAATTCTCGAGAATTCCATGTTTAAATCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000448350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026484.3-943s21c1
Sequence:CCGGCCGAAGTGCCACCTGATTATGCTCGAGCATAATCAGGTGGCACTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026484
VALIDATED
CCNY MISSION shRNA shRNA Plasmid DNA
cyclin Y
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106080    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026484.2-3466s1c1
Sequence:CCGGGCCAAATATGAATGCCTCTTACTCGAGTAAGAGGCATTCATATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026484.2-856s1c1
Sequence:CCGGGCGATATATTACCACATCAAACTCGAGTTTGATGTGGTAATATATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026484.2-1075s1c1
Sequence:CCGGCTCTTGACATACGCAGAGATTCTCGAGAATCTCTGCGTATGTCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026484.2-1108s1c1
Sequence:CCGGGCCAATTGGAAGCGCATTGTTCTCGAGAACAATGCGCTTCCAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026484.2-630s1c1
Sequence:CCGGCGACGATTTAAACATGGAATTCTCGAGAATTCCATGTTTAAATCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000448350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026484.3-943s21c1
Sequence:CCGGCCGAAGTGCCACCTGATTATGCTCGAGCATAATCAGGTGGCACTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026484
VALIDATED
CCNY MISSION shRNA Lentiviral Transduction Particles
cyclin Y
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106080    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026484.2-3466s1c1
Sequence:CCGGGCCAAATATGAATGCCTCTTACTCGAGTAAGAGGCATTCATATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026484.2-856s1c1
Sequence:CCGGGCGATATATTACCACATCAAACTCGAGTTTGATGTGGTAATATATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026484.2-1075s1c1
Sequence:CCGGCTCTTGACATACGCAGAGATTCTCGAGAATCTCTGCGTATGTCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026484.2-1108s1c1
Sequence:CCGGGCCAATTGGAAGCGCATTGTTCTCGAGAACAATGCGCTTCCAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026484.2-630s1c1
Sequence:CCGGCGACGATTTAAACATGGAATTCTCGAGAATTCCATGTTTAAATCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000448350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026484.3-943s21c1
Sequence:CCGGCCGAAGTGCCACCTGATTATGCTCGAGCATAATCAGGTGGCACTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks