EMAIL THIS PAGE TO A FRIEND

CCNYL1

cyclin Y-like 1

80 Gene Product Result for
UniProtKB ID: Q8N7R7, Q6NX60
Gene ID:
Mouse(227210) cyclin Y-like 1
Rat(316452) cyclin Y-like 1
naked mole-rat(101709022) cyclin Y-like 1
sheep(101118334) cyclin Y-like 1
Zebrafish(767752) cyclin Y-like 1
cow(538167) cyclin Y-like 1
domestic cat(101091961) cyclin Y-like 1
dog(488492) cyclin Y-like 1
chicken(424093) cyclin Y-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152523 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152523 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152523 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001097644 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001097644 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001097644 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152523 Rosetta Predictions human pricing
XM_001072068 Rosetta Predictions rat pricing
XM_237211 Rosetta Predictions rat pricing
NM_001097644 Rosetta Predictions mouse pricing
XM_001001762 Rosetta Predictions mouse pricing
XM_001001771 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152523 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206912 predicted 725
2 SASI_Hs01_00206913 predicted 1125
3 SASI_Hs01_00206914 predicted 1123
4 SASI_Hs01_00206915 predicted 982
5 SASI_Hs01_00206916 predicted 597
6 SASI_Hs01_00206917 predicted 1094
7 SASI_Hs01_00206918 predicted 417
8 SASI_Hs01_00206919 predicted 418
9 SASI_Hs01_00206920 predicted 727
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072068 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00337676 predicted 558
2 SASI_Rn02_00337677 predicted 363
3 SASI_Rn02_00337678 predicted 513
4 SASI_Rn02_00337679 predicted 451
5 SASI_Rn02_00337680 predicted 442
6 SASI_Rn02_00337681 predicted 678
7 SASI_Rn02_00337682 predicted 779
8 SASI_Rn02_00337683 predicted 908
9 SASI_Rn02_00337684 predicted 432
10 SASI_Rn02_00337685 predicted 736
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_237211 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390727 predicted 557
2 SASI_Rn02_00390728 predicted 368
3 SASI_Rn02_00390729 predicted 518
4 SASI_Rn02_00390730 predicted 450
5 SASI_Rn02_00390731 predicted 441
6 SASI_Rn02_00390732 predicted 681
7 SASI_Rn02_00390733 predicted 782
8 SASI_Rn02_00390734 predicted 907
9 SASI_Rn02_00390735 predicted 432
10 SASI_Rn02_00390736 predicted 729
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001097644 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301196 predicted 862
2 SASI_Mm02_00301197 predicted 622
3 SASI_Mm02_00301198 predicted 655
4 SASI_Mm02_00301199 predicted 493
5 SASI_Mm02_00301200 predicted 788
6 SASI_Mm02_00301201 predicted 454
7 SASI_Mm02_00301202 predicted 719
8 SASI_Mm02_00301203 predicted 583
9 SASI_Mm02_00301204 predicted 531
10 SASI_Mm02_00301205 predicted 374
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001001762 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00261560 predicted 1792
2 SASI_Mm01_00261561 predicted 2188
3 SASI_Mm01_00261562 predicted 1736
4 SASI_Mm01_00261563 predicted 2151
5 SASI_Mm01_00261564 predicted 2146
6 SASI_Mm01_00261565 predicted 2328
7 SASI_Mm01_00261566 predicted 2365
8 SASI_Mm01_00261567 predicted 2374
9 SASI_Mm01_00261568 predicted 2270
10 SASI_Mm01_00261569 predicted 2225
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001001771 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00203953 predicted 1798
2 SASI_Mm01_00203954 predicted 2552
3 SASI_Mm01_00203955 predicted 2309
4 SASI_Mm01_00203956 predicted 2341
5 SASI_Mm01_00203957 predicted 2185
6 SASI_Mm01_00203958 predicted 1743
7 SASI_Mm01_00203959 predicted 2149
8 SASI_Mm01_00203960 predicted 2410
9 SASI_Mm01_00203961 predicted 2528
10 SASI_Mm01_00203962 predicted 2278
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152523
CCNYL1 MISSION shRNA Bacterial Glycerol Stock
cyclin Y-like 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152523.2-1003s21c1
Sequence:CCGGTCCTTAGCAGATGACAACAACCTCGAGGTTGTTGTCATCTGCTAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152523.2-1139s21c1
Sequence:CCGGCTGATAACTTCATTGGTATTCCTCGAGGAATACCAATGAAGTTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152523.2-603s21c1
Sequence:CCGGTGAGAGATCACATCCACTTACCTCGAGGTAAGTGGATGTGATCTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152523.2-1607s21c1
Sequence:CCGGATCAATGCAGTATTACCATTACTCGAGTAATGGTAATACTGCATTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152523.1-419s1c1
Sequence:CCGGGCAACCATTTGAACCATGTATCTCGAGATACATGGTTCAAATGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152523.1-979s1c1
Sequence:CCGGGCCAAATACTACTTTGACCTTCTCGAGAAGGTCAAAGTAGTATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152523.1-577s1c1
Sequence:CCGGGCAAATAGATCCCTGGATATTCTCGAGAATATCCAGGGATCTATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148097    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152523.1-1477s1c1
Sequence:CCGGGCTGTGAACTATGTAAGGTTTCTCGAGAAACCTTACATAGTTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152523.1-904s1c1
Sequence:CCGGGAGGACATGAATGAAATGGAACTCGAGTTCCATTTCATTCATGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152523
CCNYL1 MISSION shRNA shRNA Plasmid DNA
cyclin Y-like 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152523.2-1003s21c1
Sequence:CCGGTCCTTAGCAGATGACAACAACCTCGAGGTTGTTGTCATCTGCTAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152523.2-1139s21c1
Sequence:CCGGCTGATAACTTCATTGGTATTCCTCGAGGAATACCAATGAAGTTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152523.2-603s21c1
Sequence:CCGGTGAGAGATCACATCCACTTACCTCGAGGTAAGTGGATGTGATCTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152523.2-1607s21c1
Sequence:CCGGATCAATGCAGTATTACCATTACTCGAGTAATGGTAATACTGCATTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152523.1-419s1c1
Sequence:CCGGGCAACCATTTGAACCATGTATCTCGAGATACATGGTTCAAATGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152523.1-979s1c1
Sequence:CCGGGCCAAATACTACTTTGACCTTCTCGAGAAGGTCAAAGTAGTATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152523.1-577s1c1
Sequence:CCGGGCAAATAGATCCCTGGATATTCTCGAGAATATCCAGGGATCTATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148097    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152523.1-1477s1c1
Sequence:CCGGGCTGTGAACTATGTAAGGTTTCTCGAGAAACCTTACATAGTTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152523.1-904s1c1
Sequence:CCGGGAGGACATGAATGAAATGGAACTCGAGTTCCATTTCATTCATGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152523
CCNYL1 MISSION shRNA Lentiviral Transduction Particles
cyclin Y-like 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152523.2-1003s21c1
Sequence:CCGGTCCTTAGCAGATGACAACAACCTCGAGGTTGTTGTCATCTGCTAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152523.2-1139s21c1
Sequence:CCGGCTGATAACTTCATTGGTATTCCTCGAGGAATACCAATGAAGTTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152523.2-603s21c1
Sequence:CCGGTGAGAGATCACATCCACTTACCTCGAGGTAAGTGGATGTGATCTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152523.2-1607s21c1
Sequence:CCGGATCAATGCAGTATTACCATTACTCGAGTAATGGTAATACTGCATTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152523.1-419s1c1
Sequence:CCGGGCAACCATTTGAACCATGTATCTCGAGATACATGGTTCAAATGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152523.1-979s1c1
Sequence:CCGGGCCAAATACTACTTTGACCTTCTCGAGAAGGTCAAAGTAGTATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152523.1-577s1c1
Sequence:CCGGGCAAATAGATCCCTGGATATTCTCGAGAATATCCAGGGATCTATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148097    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152523.1-1477s1c1
Sequence:CCGGGCTGTGAACTATGTAAGGTTTCTCGAGAAACCTTACATAGTTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152523.1-904s1c1
Sequence:CCGGGAGGACATGAATGAAATGGAACTCGAGTTCCATTTCATTCATGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001097644
CCNYL1 MISSION shRNA Bacterial Glycerol Stock
cyclin Y-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097644.1-460s21c1
Sequence:CCGGTGCAATAGTGACGTTGGTTTACTCGAGTAAACCAACGTCACTATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097644.1-863s21c1
Sequence:CCGGAGATCTTTAAGCGCTGATAATCTCGAGATTATCAGCGCTTAAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097644.1-887s21c1
Sequence:CCGGATTGGTATTCAGCGCTCTAATCTCGAGATTAGAGCGCTGAATACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252441    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001097644.1-1623s21c1
Sequence:CCGGGTAGCCTCATTAGGTATTAAACTCGAGTTTAATACCTAATGAGGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097644.1-498s21c1
Sequence:CCGGCTTATGCTGAGATCGACATTTCTCGAGAAATGTCGATCTCAGCATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001097644
CCNYL1 MISSION shRNA shRNA Plasmid DNA
cyclin Y-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097644.1-460s21c1
Sequence:CCGGTGCAATAGTGACGTTGGTTTACTCGAGTAAACCAACGTCACTATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097644.1-863s21c1
Sequence:CCGGAGATCTTTAAGCGCTGATAATCTCGAGATTATCAGCGCTTAAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097644.1-887s21c1
Sequence:CCGGATTGGTATTCAGCGCTCTAATCTCGAGATTAGAGCGCTGAATACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252441    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001097644.1-1623s21c1
Sequence:CCGGGTAGCCTCATTAGGTATTAAACTCGAGTTTAATACCTAATGAGGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097644.1-498s21c1
Sequence:CCGGCTTATGCTGAGATCGACATTTCTCGAGAAATGTCGATCTCAGCATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001097644
CCNYL1 MISSION shRNA Lentiviral Transduction Particles
cyclin Y-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097644.1-460s21c1
Sequence:CCGGTGCAATAGTGACGTTGGTTTACTCGAGTAAACCAACGTCACTATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097644.1-863s21c1
Sequence:CCGGAGATCTTTAAGCGCTGATAATCTCGAGATTATCAGCGCTTAAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097644.1-887s21c1
Sequence:CCGGATTGGTATTCAGCGCTCTAATCTCGAGATTAGAGCGCTGAATACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252441    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001097644.1-1623s21c1
Sequence:CCGGGTAGCCTCATTAGGTATTAAACTCGAGTTTAATACCTAATGAGGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097644.1-498s21c1
Sequence:CCGGCTTATGCTGAGATCGACATTTCTCGAGAAATGTCGATCTCAGCATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks