EMAIL THIS PAGE TO A FRIEND

CCP110

centriolar coiled coil protein 110kDa

223 Gene Product Result for
Synonyms: CP110 Cep110
UniProtKB ID: O43303, B7WP23, O43335, Q68DV9, Q8NE13
Gene ID:
Mouse(101565) centriolar coiled coil protein 110
Rat(361634) centriolar coiled coil protein 110kDa
chicken(416613) centriolar coiled coil protein 110kDa
domestic cat(101085425) centriolar coiled coil protein 110kDa
dog(479826) centriolar coiled coil protein 110kDa
Horse(100049946) centriolar coiled coil protein 110kDa
cow(538197) centriolar coiled coil protein 110kDa
sheep(101117720) centriolar coiled coil protein 110kDa
domestic guinea pig(100734477) centriolar coiled coil protein 110kDa
naked mole-rat(101702685) centriolar coiled coil protein 110kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014711 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014711 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014711 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_182995 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_182995 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_182995 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014711 Rosetta Predictions human pricing
NM_001108501 Rosetta Predictions rat pricing
NM_182995 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014711 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059366 predicted 680
2 SASI_Hs02_00346135 predicted 883
3 SASI_Hs01_00059367 predicted 1648
4 SASI_Hs01_00059369 predicted 2824
5 SASI_Hs01_00059370 predicted 1022
6 SASI_Hs02_00346136 predicted 1494
7 SASI_Hs01_00059371 predicted 868
8 SASI_Hs01_00059372 predicted 2651
9 SASI_Hs01_00059375 predicted 1798
10 SASI_Hs02_00346137 predicted 1109
11 SASI_Hs01_00059368 predicted 2849
12 SASI_Hs01_00059373 predicted 1228
13 SASI_Hs01_00059374 predicted 678
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108501 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239269 predicted 601
2 SASI_Rn02_00239270 predicted 2285
3 SASI_Rn02_00239271 predicted 2885
4 SASI_Rn02_00239272 predicted 1178
5 SASI_Rn02_00239273 predicted 2758
6 SASI_Rn02_00239274 predicted 1670
7 SASI_Rn02_00239275 predicted 1644
8 SASI_Rn02_00239276 predicted 3054
9 SASI_Rn02_00239277 predicted 976
10 SASI_Rn02_00239278 predicted 2196
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182995 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085361 predicted 2614
2 SASI_Mm01_00085362 predicted 2161
3 SASI_Mm01_00085363 predicted 2881
4 SASI_Mm01_00085364 predicted 973
5 SASI_Mm01_00085365 predicted 570
6 SASI_Mm01_00085366 predicted 1170
7 SASI_Mm01_00085367 predicted 1466
8 SASI_Mm01_00085368 predicted 1844
9 SASI_Mm02_00350004 predicted 1903
10 SASI_Mm01_00085369 predicted 620
11 SASI_Mm01_00085370 predicted 1161
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014711
VALIDATED
CCP110 MISSION shRNA Bacterial Glycerol Stock
centriolar coiled coil protein 110kDa
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014711.3-3291s1c1
Sequence:CCGGCGGCCAAATGTTGCGACAATTCTCGAGAATTGTCGCAACATTTGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014711.3-2795s1c1
Sequence:CCGGCGTAGACTTATGCAGACAGATCTCGAGATCTGTCTGCATAAGTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014711.3-5204s1c1
Sequence:CCGGGCTTTAGAGTAAGGATGAGAACTCGAGTTCTCATCCTTACTCTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138153    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014711.3-4644s1c1
Sequence:CCGGCGTGACTTCATGAGGGAGAATCTCGAGATTCTCCCTCATGAAGTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014711.3-1625s1c1
Sequence:CCGGCCCGAAATTATGCCAAAGTTACTCGAGTAACTTTGGCATAATTTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014711.3-1624s1c1
Sequence:CCGGGCCCGAAATTATGCCAAAGTTCTCGAGAACTTTGGCATAATTTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014711.4-3278s21c1
Sequence:CCGGTTAGTAGACAAGGGAGTATATCTCGAGATATACTCCCTTGTCTACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014711.4-3464s21c1
Sequence:CCGGGAGCACTTATCTGGATCATTTCTCGAGAAATGATCCAGATAAGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014711.4-3320s21c1
Sequence:CCGGCGGCCAAATGTTGCGACAATTCTCGAGAATTGTCGCAACATTTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014711.4-2992s21c1
Sequence:CCGGTACGGTATTCATGACATATTCCTCGAGGAATATGTCATGAATACCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014711.4-1654s21c1
Sequence:CCGGCCCGAAATTATGCCAAAGTTACTCGAGTAACTTTGGCATAATTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014711
VALIDATED
CCP110 MISSION shRNA shRNA Plasmid DNA
centriolar coiled coil protein 110kDa
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014711.3-3291s1c1
Sequence:CCGGCGGCCAAATGTTGCGACAATTCTCGAGAATTGTCGCAACATTTGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014711.3-2795s1c1
Sequence:CCGGCGTAGACTTATGCAGACAGATCTCGAGATCTGTCTGCATAAGTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014711.3-5204s1c1
Sequence:CCGGGCTTTAGAGTAAGGATGAGAACTCGAGTTCTCATCCTTACTCTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138153    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014711.3-4644s1c1
Sequence:CCGGCGTGACTTCATGAGGGAGAATCTCGAGATTCTCCCTCATGAAGTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014711.3-1625s1c1
Sequence:CCGGCCCGAAATTATGCCAAAGTTACTCGAGTAACTTTGGCATAATTTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014711.3-1624s1c1
Sequence:CCGGGCCCGAAATTATGCCAAAGTTCTCGAGAACTTTGGCATAATTTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014711.4-3278s21c1
Sequence:CCGGTTAGTAGACAAGGGAGTATATCTCGAGATATACTCCCTTGTCTACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014711.4-3464s21c1
Sequence:CCGGGAGCACTTATCTGGATCATTTCTCGAGAAATGATCCAGATAAGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014711.4-3320s21c1
Sequence:CCGGCGGCCAAATGTTGCGACAATTCTCGAGAATTGTCGCAACATTTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014711.4-2992s21c1
Sequence:CCGGTACGGTATTCATGACATATTCCTCGAGGAATATGTCATGAATACCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014711.4-1654s21c1
Sequence:CCGGCCCGAAATTATGCCAAAGTTACTCGAGTAACTTTGGCATAATTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014711
VALIDATED
CCP110 MISSION shRNA Lentiviral Transduction Particles
centriolar coiled coil protein 110kDa
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014711.3-3291s1c1
Sequence:CCGGCGGCCAAATGTTGCGACAATTCTCGAGAATTGTCGCAACATTTGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014711.3-2795s1c1
Sequence:CCGGCGTAGACTTATGCAGACAGATCTCGAGATCTGTCTGCATAAGTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014711.3-5204s1c1
Sequence:CCGGGCTTTAGAGTAAGGATGAGAACTCGAGTTCTCATCCTTACTCTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138153    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014711.3-4644s1c1
Sequence:CCGGCGTGACTTCATGAGGGAGAATCTCGAGATTCTCCCTCATGAAGTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014711.3-1625s1c1
Sequence:CCGGCCCGAAATTATGCCAAAGTTACTCGAGTAACTTTGGCATAATTTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014711.3-1624s1c1
Sequence:CCGGGCCCGAAATTATGCCAAAGTTCTCGAGAACTTTGGCATAATTTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014711.4-3278s21c1
Sequence:CCGGTTAGTAGACAAGGGAGTATATCTCGAGATATACTCCCTTGTCTACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014711.4-3464s21c1
Sequence:CCGGGAGCACTTATCTGGATCATTTCTCGAGAAATGATCCAGATAAGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014711.4-3320s21c1
Sequence:CCGGCGGCCAAATGTTGCGACAATTCTCGAGAATTGTCGCAACATTTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014711.4-2992s21c1
Sequence:CCGGTACGGTATTCATGACATATTCCTCGAGGAATATGTCATGAATACCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014711.4-1654s21c1
Sequence:CCGGCCCGAAATTATGCCAAAGTTACTCGAGTAACTTTGGCATAATTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182995
VALIDATED
CCP110 MISSION shRNA Bacterial Glycerol Stock
centriolar coiled coil protein 110kDa
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000192420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182995.1-3144s1c1
Sequence:CCGGCCGTTCATAGGCTACTTAGTACTCGAGTACTAAGTAGCCTATGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191839    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182995.1-3514s1c1
Sequence:CCGGGCATTTAGTAATTGCCTTGTTCTCGAGAACAAGGCAATTACTAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191650    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182995.1-4682s1c1
Sequence:CCGGGCTCAAAGTTTGTGTGTATTACTCGAGTAATACACACAAACTTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182995.1-1172s1c1
Sequence:CCGGCCAAGCCTTAATAAGTCAAATCTCGAGATTTGACTTATTAAGGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182995
VALIDATED
CCP110 MISSION shRNA shRNA Plasmid DNA
centriolar coiled coil protein 110kDa
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000192420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182995.1-3144s1c1
Sequence:CCGGCCGTTCATAGGCTACTTAGTACTCGAGTACTAAGTAGCCTATGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191839    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182995.1-3514s1c1
Sequence:CCGGGCATTTAGTAATTGCCTTGTTCTCGAGAACAAGGCAATTACTAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191650    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182995.1-4682s1c1
Sequence:CCGGGCTCAAAGTTTGTGTGTATTACTCGAGTAATACACACAAACTTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182995.1-1172s1c1
Sequence:CCGGCCAAGCCTTAATAAGTCAAATCTCGAGATTTGACTTATTAAGGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182995
VALIDATED
CCP110 MISSION shRNA Lentiviral Transduction Particles
centriolar coiled coil protein 110kDa
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000192420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182995.1-3144s1c1
Sequence:CCGGCCGTTCATAGGCTACTTAGTACTCGAGTACTAAGTAGCCTATGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191839    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182995.1-3514s1c1
Sequence:CCGGGCATTTAGTAATTGCCTTGTTCTCGAGAACAAGGCAATTACTAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191650    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182995.1-4682s1c1
Sequence:CCGGGCTCAAAGTTTGTGTGTATTACTCGAGTAATACACACAAACTTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182995.1-1172s1c1
Sequence:CCGGCCAAGCCTTAATAAGTCAAATCTCGAGATTTGACTTATTAAGGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks