EMAIL THIS PAGE TO A FRIEND

CCPG1

cell cycle progression 1

147 Gene Product Result for
Synonyms: CPR8
Gene ID:
Mouse(72278) cell cycle progression 1
Rat(363098) cell cycle progression 1
Zebrafish(492785) cell cycle progression 1
cow(538508) cell cycle progression 1
Horse(100069165) cell cycle progression 1
domestic cat(101086397) cell cycle progression 1
dog(487566) cell cycle progression 1
chicken(427496) cell cycle progression 1
naked mole-rat(101715618) cell cycle progression 1
domestic guinea pig(100721532) cell cycle progression 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028181 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028181 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028181 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004748 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004748 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004748 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU061051 MISSION® esiRNA esiRNA targeting mouse Ccpg1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004748 Rosetta Predictions human pricing
NM_020739 Rosetta Predictions human pricing
NM_001108770 Rosetta Predictions rat pricing
NM_001114328 Rosetta Predictions mouse pricing
NM_028181 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004748 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338232 predicted 2320
2 SASI_Hs01_00042182 predicted 2079
3 SASI_Hs01_00042183 predicted 1824
4 SASI_Hs02_00338233 predicted 1118
5 SASI_Hs01_00042185 predicted 1444
6 SASI_Hs01_00042186 predicted 400
7 SASI_Hs01_00042187 predicted 1335
8 SASI_Hs01_00042189 predicted 1355
9 SASI_Hs01_00042190 predicted 770
10 SASI_Hs01_00042191 predicted 616
11 SASI_Hs01_00042184 predicted 336
12 SASI_Hs01_00042188 predicted 377
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020739 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353835 predicted 2349
2 SASI_Hs01_00211801 predicted 2107
3 SASI_Hs01_00211802 predicted 1864
4 SASI_Hs02_00353836 predicted 1144
5 SASI_Hs01_00211804 predicted 1476
6 SASI_Hs01_00211805 predicted 434
7 SASI_Hs01_00211806 predicted 1366
8 SASI_Hs01_00211808 predicted 1389
9 SASI_Hs01_00211809 predicted 802
10 SASI_Hs01_00211810 predicted 649
11 SASI_Hs01_00211803 predicted 371
12 SASI_Hs01_00211807 predicted 413
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108770 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241905 predicted 1116
2 SASI_Rn02_00241906 predicted 385
3 SASI_Rn02_00241907 predicted 1554
4 SASI_Rn02_00241908 predicted 315
5 SASI_Rn02_00241909 predicted 633
6 SASI_Rn02_00241910 predicted 1963
7 SASI_Rn02_00241911 predicted 1924
8 SASI_Rn02_00241912 predicted 1080
9 SASI_Rn02_00241913 predicted 1144
10 SASI_Rn02_00241914 predicted 1675
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114328 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308520 predicted 405
2 SASI_Mm02_00308521 predicted 241
3 SASI_Mm02_00308522 predicted 1580
4 SASI_Mm02_00308523 predicted 1219
5 SASI_Mm02_00308524 predicted 447
6 SASI_Mm02_00308525 predicted 226
7 SASI_Mm02_00308526 predicted 276
8 SASI_Mm02_00308527 predicted 1703
9 SASI_Mm02_00308528 predicted 756
10 SASI_Mm02_00308529 predicted 1455
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028181 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030110 predicted 413
2 SASI_Mm01_00030111 predicted 245
3 SASI_Mm01_00030113 predicted 1583
4 SASI_Mm01_00030114 predicted 1218
5 SASI_Mm01_00030115 predicted 443
6 SASI_Mm01_00030116 predicted 233
7 SASI_Mm01_00030119 predicted 277
8 SASI_Mm02_00333464 predicted 1704
9 SASI_Mm02_00333465 predicted 759
10 SASI_Mm02_00333466 predicted 1462
11 SASI_Mm01_00030112 predicted 1792
12 SASI_Mm01_00030117 predicted 1937
13 SASI_Mm01_00030118 predicted 2074
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028181
VALIDATED
CCPG1 MISSION shRNA Bacterial Glycerol Stock
cell cycle progression 1
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000277530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028181.4-748s21c1
Sequence:CCGGGAGCCAAGTAAACGCCACTTTCTCGAGAAAGTGGCGTTTACTTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028181.4-1633s21c1
Sequence:CCGGGAGTTTGTGAGACATCATAAACTCGAGTTTATGATGTCTCACAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028181.4-923s21c1
Sequence:CCGGGCAAGCAGGAACAAGAGTCTTCTCGAGAAGACTCTTGTTCCTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216502    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028181.4-2104s1c1
Sequence:CCGGCTTATGAAAGGGAAGGTAAATCTCGAGATTTACCTTCCCTTTCATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028181.4-1182s21c1
Sequence:CCGGCCAGGTCCTTAAGCAGTACTTCTCGAGAAGTACTGCTTAAGGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028181.4-2193s21c1
Sequence:CCGGTTCGATCCTAAGTACTGATTTCTCGAGAAATCAGTACTTAGGATCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197379    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028181.1-469s1c1
Sequence:CCGGCCAGGAAGTTACAATTCAAGACTCGAGTCTTGAATTGTAACTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028181.1-419s1c1
Sequence:CCGGGATTCGGATATTGTTACACTTCTCGAGAAGTGTAACAATATCCGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028181.1-257s1c1
Sequence:CCGGCCCGTTCTTTATGTAGGGCATCTCGAGATGCCCTACATAAAGAACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028181.1-1705s1c1
Sequence:CCGGCCATTTCAAAGATACTACCAACTCGAGTTGGTAGTATCTTTGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028181.1-1156s1c1
Sequence:CCGGCCAGGTCCTTAAGCAGTACTTCTCGAGAAGTACTGCTTAAGGACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028181.1-897s1c1
Sequence:CCGGGCAAGCAGGAACAAGAGTCTTCTCGAGAAGACTCTTGTTCCTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028181.1-722s1c1
Sequence:CCGGGAGCCAAGTAAACGCCACTTTCTCGAGAAAGTGGCGTTTACTTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028181
VALIDATED
CCPG1 MISSION shRNA shRNA Plasmid DNA
cell cycle progression 1
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000277530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028181.4-748s21c1
Sequence:CCGGGAGCCAAGTAAACGCCACTTTCTCGAGAAAGTGGCGTTTACTTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028181.4-1633s21c1
Sequence:CCGGGAGTTTGTGAGACATCATAAACTCGAGTTTATGATGTCTCACAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028181.4-923s21c1
Sequence:CCGGGCAAGCAGGAACAAGAGTCTTCTCGAGAAGACTCTTGTTCCTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216502    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028181.4-2104s1c1
Sequence:CCGGCTTATGAAAGGGAAGGTAAATCTCGAGATTTACCTTCCCTTTCATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028181.4-1182s21c1
Sequence:CCGGCCAGGTCCTTAAGCAGTACTTCTCGAGAAGTACTGCTTAAGGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028181.4-2193s21c1
Sequence:CCGGTTCGATCCTAAGTACTGATTTCTCGAGAAATCAGTACTTAGGATCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197379    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028181.1-469s1c1
Sequence:CCGGCCAGGAAGTTACAATTCAAGACTCGAGTCTTGAATTGTAACTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028181.1-419s1c1
Sequence:CCGGGATTCGGATATTGTTACACTTCTCGAGAAGTGTAACAATATCCGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028181.1-257s1c1
Sequence:CCGGCCCGTTCTTTATGTAGGGCATCTCGAGATGCCCTACATAAAGAACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028181.1-1705s1c1
Sequence:CCGGCCATTTCAAAGATACTACCAACTCGAGTTGGTAGTATCTTTGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028181.1-1156s1c1
Sequence:CCGGCCAGGTCCTTAAGCAGTACTTCTCGAGAAGTACTGCTTAAGGACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028181.1-897s1c1
Sequence:CCGGGCAAGCAGGAACAAGAGTCTTCTCGAGAAGACTCTTGTTCCTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028181.1-722s1c1
Sequence:CCGGGAGCCAAGTAAACGCCACTTTCTCGAGAAAGTGGCGTTTACTTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028181
VALIDATED
CCPG1 MISSION shRNA Lentiviral Transduction Particles
cell cycle progression 1
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000277530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028181.4-748s21c1
Sequence:CCGGGAGCCAAGTAAACGCCACTTTCTCGAGAAAGTGGCGTTTACTTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028181.4-1633s21c1
Sequence:CCGGGAGTTTGTGAGACATCATAAACTCGAGTTTATGATGTCTCACAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028181.4-923s21c1
Sequence:CCGGGCAAGCAGGAACAAGAGTCTTCTCGAGAAGACTCTTGTTCCTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216502    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028181.4-2104s1c1
Sequence:CCGGCTTATGAAAGGGAAGGTAAATCTCGAGATTTACCTTCCCTTTCATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028181.4-1182s21c1
Sequence:CCGGCCAGGTCCTTAAGCAGTACTTCTCGAGAAGTACTGCTTAAGGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028181.4-2193s21c1
Sequence:CCGGTTCGATCCTAAGTACTGATTTCTCGAGAAATCAGTACTTAGGATCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197379    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028181.1-469s1c1
Sequence:CCGGCCAGGAAGTTACAATTCAAGACTCGAGTCTTGAATTGTAACTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028181.1-419s1c1
Sequence:CCGGGATTCGGATATTGTTACACTTCTCGAGAAGTGTAACAATATCCGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028181.1-257s1c1
Sequence:CCGGCCCGTTCTTTATGTAGGGCATCTCGAGATGCCCTACATAAAGAACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028181.1-1705s1c1
Sequence:CCGGCCATTTCAAAGATACTACCAACTCGAGTTGGTAGTATCTTTGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028181.1-1156s1c1
Sequence:CCGGCCAGGTCCTTAAGCAGTACTTCTCGAGAAGTACTGCTTAAGGACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028181.1-897s1c1
Sequence:CCGGGCAAGCAGGAACAAGAGTCTTCTCGAGAAGACTCTTGTTCCTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028181.1-722s1c1
Sequence:CCGGGAGCCAAGTAAACGCCACTTTCTCGAGAAAGTGGCGTTTACTTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004748
VALIDATED
CCPG1 MISSION shRNA Bacterial Glycerol Stock
cell cycle progression 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004748.3-3099s21c1
Sequence:CCGGGCTGGTATCTAGTCCTATAATCTCGAGATTATAGGACTAGATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004748.3-402s21c1
Sequence:CCGGTACCCGAAGACAGTATCTATACTCGAGTATAGATACTGTCTTCGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_004748.3-1159s21c1
Sequence:CCGGGACAAGTACTGAATTAGTTAACTCGAGTTAACTAATTCAGTACTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004748.3-897s21c1
Sequence:CCGGTGAATGATATGAAGGATTATCCTCGAGGATAATCCTTCATATCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004748.3-2280s21c1
Sequence:CCGGTAGATAATGATGGAGTATTTGCTCGAGCAAATACTCCATCATTATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004748.2-546s1c1
Sequence:CCGGCCACCTAAGTTAGAAGAAATTCTCGAGAATTTCTTCTAACTTAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004748
VALIDATED
CCPG1 MISSION shRNA shRNA Plasmid DNA
cell cycle progression 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004748.3-3099s21c1
Sequence:CCGGGCTGGTATCTAGTCCTATAATCTCGAGATTATAGGACTAGATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004748.3-402s21c1
Sequence:CCGGTACCCGAAGACAGTATCTATACTCGAGTATAGATACTGTCTTCGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_004748.3-1159s21c1
Sequence:CCGGGACAAGTACTGAATTAGTTAACTCGAGTTAACTAATTCAGTACTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004748.3-897s21c1
Sequence:CCGGTGAATGATATGAAGGATTATCCTCGAGGATAATCCTTCATATCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004748.3-2280s21c1
Sequence:CCGGTAGATAATGATGGAGTATTTGCTCGAGCAAATACTCCATCATTATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004748.2-546s1c1
Sequence:CCGGCCACCTAAGTTAGAAGAAATTCTCGAGAATTTCTTCTAACTTAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004748
VALIDATED
CCPG1 MISSION shRNA Lentiviral Transduction Particles
cell cycle progression 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004748.3-3099s21c1
Sequence:CCGGGCTGGTATCTAGTCCTATAATCTCGAGATTATAGGACTAGATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004748.3-402s21c1
Sequence:CCGGTACCCGAAGACAGTATCTATACTCGAGTATAGATACTGTCTTCGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_004748.3-1159s21c1
Sequence:CCGGGACAAGTACTGAATTAGTTAACTCGAGTTAACTAATTCAGTACTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004748.3-897s21c1
Sequence:CCGGTGAATGATATGAAGGATTATCCTCGAGGATAATCCTTCATATCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004748.3-2280s21c1
Sequence:CCGGTAGATAATGATGGAGTATTTGCTCGAGCAAATACTCCATCATTATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004748.2-546s1c1
Sequence:CCGGCCACCTAAGTTAGAAGAAATTCTCGAGAATTTCTTCTAACTTAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks