EMAIL THIS PAGE TO A FRIEND

CCR10

chemokine (C-C motif) receptor 10

64 Gene Product Result for
Synonyms: GPR2
UniProtKB ID: P46092, Q4V749, Q6T7X2, Q9NZG2
Gene ID:
Human(2826) Summary: Chemokines are a group of small (approximately 8 to 14 kD), mostly basic, structurally related molecules that regulate cell trafficking of various types of leukocytes through interactions with a subset of 7-transmembrane, G protein-coupled receptors. Chemokines also play fundamental roles in the development, homeostasis, and function of the immune system, and they have effects on cells of the central nervous system as well as on endothelial cells involved in angiogenesis or angiostasis. Chemokines are divided into 2 major subfamilies, CXC and CC, based on the arrangement of the first 2 of the 4 conserved cysteine residues; the 2 cysteines are separated by a single amino acid in CXC chemokines and are adjacent in CC chemokines. CCR10 is the receptor for CCL27 (SCYA27; MIM 604833); CCR10-CCL27 interactions are involved in T cell-mediated skin inflammation (Homey et al., 2002 [PubMed 11821900]
Mouse(12777) chemokine (C-C motif) receptor 10
Rat(363682) chemokine (C-C motif) receptor 10
sheep(678671) chemokine (C-C motif) receptor 10
Domestic Rabbit(100144330) chemokine (C-C motif) receptor 10
domestic guinea pig(100720419) chemokine (C-C motif) receptor 10
naked mole-rat(101714793) chemokine (C-C motif) receptor 10
Zebrafish(436948) chemokine (C-C motif) receptor 10
chicken(100858200) chemokine (C-C motif) receptor 10
dog(607528) chemokine (C-C motif) receptor 10
cow(539108) chemokine (C-C motif) receptor 10
domestic cat(101092409) chemokine (C-C motif) receptor 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016602 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016602 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016602 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007721 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007721 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007721 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU073041 MISSION® esiRNA esiRNA targeting mouse Ccr10 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016602 Rosetta Predictions human pricing
NM_001108836 Rosetta Predictions rat pricing
NM_007721 Rosetta Predictions mouse pricing
XM_894898 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016602 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072660 predicted 350
2 SASI_Hs01_00072661 predicted 382
3 SASI_Hs01_00072663 predicted 557
4 SASI_Hs01_00072664 predicted 474
5 SASI_Hs01_00072665 predicted 783
6 SASI_Hs01_00072666 predicted 384
7 SASI_Hs01_00072668 predicted 665
8 SASI_Hs01_00072669 predicted 472
9 SASI_Hs02_00349732 predicted 560
10 SASI_Hs01_00072662 predicted 306
11 SASI_Hs01_00072667 predicted 356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108836 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242555 predicted 532
2 SASI_Rn02_00242556 predicted 1085
3 SASI_Rn02_00242557 predicted 255
4 SASI_Rn02_00242558 predicted 1100
5 SASI_Rn02_00242559 predicted 932
6 SASI_Rn02_00242560 predicted 779
7 SASI_Rn02_00242561 predicted 836
8 SASI_Rn02_00242562 predicted 492
9 SASI_Rn02_00242563 predicted 869
10 SASI_Rn02_00242564 predicted 508
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007721 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312293 predicted 1379
2 SASI_Mm02_00312294 predicted 1254
3 SASI_Mm02_00312295 predicted 1343
4 SASI_Mm02_00312296 predicted 244
5 SASI_Mm02_00312297 predicted 1239
6 SASI_Mm02_00312298 predicted 370
7 SASI_Mm02_00312299 predicted 1407
8 SASI_Mm02_00312300 predicted 777
9 SASI_Mm02_00312301 predicted 1387
10 SASI_Mm02_00312302 predicted 1003
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_894898 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00246723 predicted 646
2 SASI_Mm01_00246724 predicted 811
3 SASI_Mm01_00246725 predicted 678
4 SASI_Mm01_00246726 predicted 874
5 SASI_Mm01_00246727 predicted 780
6 SASI_Mm01_00246728 predicted 672
7 SASI_Mm01_00246729 predicted 886
8 SASI_Mm01_00246730 predicted 739
9 SASI_Mm01_00246731 predicted 820
10 SASI_Mm01_00246732 predicted 887
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016602
CCR10 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) receptor 10
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016602.2-807s21c1
Sequence:CCGGTGCTGGATACTGCCGATCTACCTCGAGGTAGATCGGCAGTATCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016602.2-386s21c1
Sequence:CCGGTTCCTCTTCCTGGCCTGTATCCTCGAGGATACAGGCCAGGAAGAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016602.2-913s21c1
Sequence:CCGGTGGCCTCAATCCCGTTCTCTACTCGAGTAGAGAACGGGATTGAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016602.1-851s1c1
Sequence:CCGGCCTGCCAGCAAACGCAAGGATCTCGAGATCCTTGCGTTTGCTGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016602.1-89s1c1
Sequence:CCGGGAGCTTTGCTACAAGGCCGATCTCGAGATCGGCCTTGTAGCAAAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016602.1-1072s1c1
Sequence:CCGGCAGTCTCTCCTGGGACAACTACTCGAGTAGTTGTCCCAGGAGAGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016602.1-806s1c1
Sequence:CCGGCTGCTGGATACTGCCGATCTACTCGAGTAGATCGGCAGTATCCAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016602.1-394s1c1
Sequence:CCGGCCTGGCCTGTATCAGCGCCGACTCGAGTCGGCGCTGATACAGGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016602
CCR10 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) receptor 10
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016602.2-807s21c1
Sequence:CCGGTGCTGGATACTGCCGATCTACCTCGAGGTAGATCGGCAGTATCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016602.2-386s21c1
Sequence:CCGGTTCCTCTTCCTGGCCTGTATCCTCGAGGATACAGGCCAGGAAGAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016602.2-913s21c1
Sequence:CCGGTGGCCTCAATCCCGTTCTCTACTCGAGTAGAGAACGGGATTGAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016602.1-851s1c1
Sequence:CCGGCCTGCCAGCAAACGCAAGGATCTCGAGATCCTTGCGTTTGCTGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016602.1-89s1c1
Sequence:CCGGGAGCTTTGCTACAAGGCCGATCTCGAGATCGGCCTTGTAGCAAAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016602.1-1072s1c1
Sequence:CCGGCAGTCTCTCCTGGGACAACTACTCGAGTAGTTGTCCCAGGAGAGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016602.1-806s1c1
Sequence:CCGGCTGCTGGATACTGCCGATCTACTCGAGTAGATCGGCAGTATCCAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016602.1-394s1c1
Sequence:CCGGCCTGGCCTGTATCAGCGCCGACTCGAGTCGGCGCTGATACAGGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016602
CCR10 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) receptor 10
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016602.2-807s21c1
Sequence:CCGGTGCTGGATACTGCCGATCTACCTCGAGGTAGATCGGCAGTATCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016602.2-386s21c1
Sequence:CCGGTTCCTCTTCCTGGCCTGTATCCTCGAGGATACAGGCCAGGAAGAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016602.2-913s21c1
Sequence:CCGGTGGCCTCAATCCCGTTCTCTACTCGAGTAGAGAACGGGATTGAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016602.1-851s1c1
Sequence:CCGGCCTGCCAGCAAACGCAAGGATCTCGAGATCCTTGCGTTTGCTGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016602.1-89s1c1
Sequence:CCGGGAGCTTTGCTACAAGGCCGATCTCGAGATCGGCCTTGTAGCAAAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016602.1-1072s1c1
Sequence:CCGGCAGTCTCTCCTGGGACAACTACTCGAGTAGTTGTCCCAGGAGAGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016602.1-806s1c1
Sequence:CCGGCTGCTGGATACTGCCGATCTACTCGAGTAGATCGGCAGTATCCAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016602.1-394s1c1
Sequence:CCGGCCTGGCCTGTATCAGCGCCGACTCGAGTCGGCGCTGATACAGGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007721
CCR10 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) receptor 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007721.3-110s1c1
Sequence:CCGGGCTCTGTTACAAGGCTGATGTCTCGAGACATCAGCCTTGTAACAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007721.3-931s1c1
Sequence:CCGGGCAGCCTCAATCCGGTGCTTTCTCGAGAAAGCACCGGATTGAGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007721.3-337s1c1
Sequence:CCGGGCTGGAATCTAGGAAGTACCACTCGAGTGGTACTTCCTAGATTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007721.3-878s1c1
Sequence:CCGGCAAGCGCAAGGATCTAGCTTTCTCGAGAAAGCTAGATCCTTGCGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007721.3-1263s1c1
Sequence:CCGGGCAACCCAACTACTGTTACTACTCGAGTAGTAACAGTAGTTGGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007721
CCR10 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) receptor 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007721.3-110s1c1
Sequence:CCGGGCTCTGTTACAAGGCTGATGTCTCGAGACATCAGCCTTGTAACAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007721.3-931s1c1
Sequence:CCGGGCAGCCTCAATCCGGTGCTTTCTCGAGAAAGCACCGGATTGAGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007721.3-337s1c1
Sequence:CCGGGCTGGAATCTAGGAAGTACCACTCGAGTGGTACTTCCTAGATTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007721.3-878s1c1
Sequence:CCGGCAAGCGCAAGGATCTAGCTTTCTCGAGAAAGCTAGATCCTTGCGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007721.3-1263s1c1
Sequence:CCGGGCAACCCAACTACTGTTACTACTCGAGTAGTAACAGTAGTTGGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007721
CCR10 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) receptor 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007721.3-110s1c1
Sequence:CCGGGCTCTGTTACAAGGCTGATGTCTCGAGACATCAGCCTTGTAACAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007721.3-931s1c1
Sequence:CCGGGCAGCCTCAATCCGGTGCTTTCTCGAGAAAGCACCGGATTGAGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007721.3-337s1c1
Sequence:CCGGGCTGGAATCTAGGAAGTACCACTCGAGTGGTACTTCCTAGATTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007721.3-878s1c1
Sequence:CCGGCAAGCGCAAGGATCTAGCTTTCTCGAGAAAGCTAGATCCTTGCGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007721.3-1263s1c1
Sequence:CCGGGCAACCCAACTACTGTTACTACTCGAGTAGTAACAGTAGTTGGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks