EMAIL THIS PAGE TO A FRIEND

CCR1

chemokine (C-C motif) receptor 1

107 Gene Product Result for
Synonyms: CD191 CKR-1 CKR1 CMKBR1 HM145 MIP1aR SCYAR1
UniProtKB ID: P32246, Q86VA9
Gene ID:
Human(1230) Summary: This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. The ligands of this receptor include macrophage inflammatory protein 1 alpha (MIP-1 alpha), regulated on activation normal T expressed and secreted protein (RANTES), monocyte chemoattractant protein 3 (MCP-3), and myeloid progenitor inhibitory factor-1 (MPIF-1). Chemokines and their receptors mediated signal transduction are critical for the recruitment of effector immune cells to the site of inflammation. Knockout studies of the mouse homolog suggested the roles of this gene in host protection from inflammatory response, and susceptibility to virus and parasite. This gene and other chemokine receptor genes, including CCR2, CCRL2, CCR3, CCR5 and CCXCR1, are found to form a gene cluster on chromosome 3p. [provided by RefSeq, Jul 2008]
Mouse(12768) chemokine (C-C motif) receptor 1
Rat(57301) chemokine (C-C motif) receptor 1
Thale Cress(820136) serine/threonine-protein kinase-like protein CCR1
cow(407771) chemokine (C-C motif) receptor 1
domestic cat(100191004) chemokine (C-C motif) receptor 1
Thale Cress(830082) glycine-rich RNA-binding protein 8
Thale Cress(838165) cinnamoyl coa reductase 1
dog(484791) chemokine (C-C motif) receptor 1
naked mole-rat(101724812) chemokine (C-C motif) receptor 1
domestic guinea pig(100716398) chemokine (C-C motif) receptor 1
Domestic Rabbit(100328940) chemokine (C-C motif) receptor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
594687 α-Sexithiophene human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001295 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001295 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001295 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009912 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009912 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009912 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU156141 MISSION® esiRNA esiRNA human CCR1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001295 Rosetta Predictions human pricing
NM_020542 Rosetta Predictions rat pricing
NM_009912 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001295 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119718 predicted 651
2 SASI_Hs01_00119719 predicted 768
3 SASI_Hs01_00119720 predicted 694
4 SASI_Hs01_00119721 predicted 995
5 SASI_Hs01_00119722 predicted 669
6 SASI_Hs01_00119723 predicted 838
7 SASI_Hs01_00119724 predicted 824
8 SASI_Hs01_00119725 predicted 949
9 SASI_Hs01_00119726 predicted 747
10 SASI_Hs01_00119727 predicted 272
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020542 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068819 predicted 600
2 SASI_Rn02_00262560 predicted 1224
3 SASI_Rn01_00068820 predicted 795
4 SASI_Rn01_00068821 predicted 625
5 SASI_Rn01_00068822 predicted 839
6 SASI_Rn01_00068823 predicted 1113
7 SASI_Rn01_00068824 predicted 701
8 SASI_Rn01_00068825 predicted 1483
9 SASI_Rn01_00068826 predicted 1112
10 SASI_Rn01_00068827 predicted 1349
11 SASI_Rn01_00068828 predicted 1079
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009912 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159731 predicted 1049
2 SASI_Mm02_00317431 predicted 1230
3 SASI_Mm01_00159733 predicted 1600
4 SASI_Mm01_00159734 predicted 1383
5 SASI_Mm01_00159735 predicted 725
6 SASI_Mm01_00159736 predicted 1178
7 SASI_Mm02_00317432 predicted 1158
8 SASI_Mm01_00159739 predicted 1574
9 SASI_Mm02_00317433 predicted 1400
10 SASI_Mm01_00159740 predicted 1470
11 SASI_Mm01_00159732 predicted 1107
12 SASI_Mm01_00159737 predicted 457
13 SASI_Mm01_00159738 predicted 834
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001295
VALIDATED
CCR1 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) receptor 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008184    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001295.1-1328s1c1
Sequence:CCGGCCCTGGTAGAAAGAAGATGAACTCGAGTTCATCTTCTTTCTACCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001295.1-613s1c1
Sequence:CCGGGCCTTCACTTTCCTCACGAAACTCGAGTTTCGTGAGGAAAGTGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001295.1-822s1c1
Sequence:CCGGCCCTACAATTTGACTATACTTCTCGAGAAGTATAGTCAAATTGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001295.1-177s1c1
Sequence:CCGGCCTCTGTACTCCTTGGTATTTCTCGAGAAATACCAAGGAGTACAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001295.1-660s1c1
Sequence:CCGGGCTCTGAAACTGAACCTCTTTCTCGAGAAAGAGGTTCAGTTTCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001295.2-1261s21c1
Sequence:CCGGGGGATAGAGAGGGAATGTAATCTCGAGATTACATTCCCTCTCTATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001295.2-187s21c1
Sequence:CCGGCTCTGTACTCCTTGGTATTTGCTCGAGCAAATACCAAGGAGTACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001295.2-1432s21c1
Sequence:CCGGATTTGTGACCATTAGCATTTGCTCGAGCAAATGCTAATGGTCACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001295.2-720s21c1
Sequence:CCGGATCTGCTACACAGGGATTATACTCGAGTATAATCCCTGTGTAGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001295.2-744s21c1
Sequence:CCGGATTCTGCTAAGACGACCAAATCTCGAGATTTGGTCGTCTTAGCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001295.2-669s21c1
Sequence:CCGGGCTCTGAAACTGAACCTCTTTCTCGAGAAAGAGGTTCAGTTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001295
VALIDATED
CCR1 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) receptor 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008184    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001295.1-1328s1c1
Sequence:CCGGCCCTGGTAGAAAGAAGATGAACTCGAGTTCATCTTCTTTCTACCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001295.1-613s1c1
Sequence:CCGGGCCTTCACTTTCCTCACGAAACTCGAGTTTCGTGAGGAAAGTGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001295.1-822s1c1
Sequence:CCGGCCCTACAATTTGACTATACTTCTCGAGAAGTATAGTCAAATTGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001295.1-177s1c1
Sequence:CCGGCCTCTGTACTCCTTGGTATTTCTCGAGAAATACCAAGGAGTACAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001295.1-660s1c1
Sequence:CCGGGCTCTGAAACTGAACCTCTTTCTCGAGAAAGAGGTTCAGTTTCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001295.2-1261s21c1
Sequence:CCGGGGGATAGAGAGGGAATGTAATCTCGAGATTACATTCCCTCTCTATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001295.2-187s21c1
Sequence:CCGGCTCTGTACTCCTTGGTATTTGCTCGAGCAAATACCAAGGAGTACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001295.2-1432s21c1
Sequence:CCGGATTTGTGACCATTAGCATTTGCTCGAGCAAATGCTAATGGTCACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001295.2-720s21c1
Sequence:CCGGATCTGCTACACAGGGATTATACTCGAGTATAATCCCTGTGTAGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001295.2-744s21c1
Sequence:CCGGATTCTGCTAAGACGACCAAATCTCGAGATTTGGTCGTCTTAGCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001295.2-669s21c1
Sequence:CCGGGCTCTGAAACTGAACCTCTTTCTCGAGAAAGAGGTTCAGTTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001295
VALIDATED
CCR1 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) receptor 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008184    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001295.1-1328s1c1
Sequence:CCGGCCCTGGTAGAAAGAAGATGAACTCGAGTTCATCTTCTTTCTACCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001295.1-613s1c1
Sequence:CCGGGCCTTCACTTTCCTCACGAAACTCGAGTTTCGTGAGGAAAGTGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001295.1-822s1c1
Sequence:CCGGCCCTACAATTTGACTATACTTCTCGAGAAGTATAGTCAAATTGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001295.1-177s1c1
Sequence:CCGGCCTCTGTACTCCTTGGTATTTCTCGAGAAATACCAAGGAGTACAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001295.1-660s1c1
Sequence:CCGGGCTCTGAAACTGAACCTCTTTCTCGAGAAAGAGGTTCAGTTTCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001295.2-1261s21c1
Sequence:CCGGGGGATAGAGAGGGAATGTAATCTCGAGATTACATTCCCTCTCTATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001295.2-187s21c1
Sequence:CCGGCTCTGTACTCCTTGGTATTTGCTCGAGCAAATACCAAGGAGTACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001295.2-1432s21c1
Sequence:CCGGATTTGTGACCATTAGCATTTGCTCGAGCAAATGCTAATGGTCACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001295.2-720s21c1
Sequence:CCGGATCTGCTACACAGGGATTATACTCGAGTATAATCCCTGTGTAGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001295.2-744s21c1
Sequence:CCGGATTCTGCTAAGACGACCAAATCTCGAGATTTGGTCGTCTTAGCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001295.2-669s21c1
Sequence:CCGGGCTCTGAAACTGAACCTCTTTCTCGAGAAAGAGGTTCAGTTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009912
CCR1 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) receptor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009912.2-1100s1c1
Sequence:CCGGCCCTACAATCTGAGTGTATTTCTCGAGAAATACACTCAGATTGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009912.2-1341s1c1
Sequence:CCGGACCAACTAGAAAGGACCAGTTCTCGAGAACTGGTCCTTTCTAGTTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009912.2-456s1c1
Sequence:CCGGCCCTGTATTCTCTAGTGTTTACTCGAGTAAACACTAGAGAATACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009912.2-970s1c1
Sequence:CCGGGCCTCTGTTAGTCATGATAATCTCGAGATTATCATGACTAACAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009912.2-715s1c1
Sequence:CCGGCCTGTTGACGATTGACAGATACTCGAGTATCTGTCAATCGTCAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009912
CCR1 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) receptor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009912.2-1100s1c1
Sequence:CCGGCCCTACAATCTGAGTGTATTTCTCGAGAAATACACTCAGATTGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009912.2-1341s1c1
Sequence:CCGGACCAACTAGAAAGGACCAGTTCTCGAGAACTGGTCCTTTCTAGTTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009912.2-456s1c1
Sequence:CCGGCCCTGTATTCTCTAGTGTTTACTCGAGTAAACACTAGAGAATACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009912.2-970s1c1
Sequence:CCGGGCCTCTGTTAGTCATGATAATCTCGAGATTATCATGACTAACAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009912.2-715s1c1
Sequence:CCGGCCTGTTGACGATTGACAGATACTCGAGTATCTGTCAATCGTCAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009912
CCR1 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) receptor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009912.2-1100s1c1
Sequence:CCGGCCCTACAATCTGAGTGTATTTCTCGAGAAATACACTCAGATTGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009912.2-1341s1c1
Sequence:CCGGACCAACTAGAAAGGACCAGTTCTCGAGAACTGGTCCTTTCTAGTTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009912.2-456s1c1
Sequence:CCGGCCCTGTATTCTCTAGTGTTTACTCGAGTAAACACTAGAGAATACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009912.2-970s1c1
Sequence:CCGGGCCTCTGTTAGTCATGATAATCTCGAGATTATCATGACTAACAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009912.2-715s1c1
Sequence:CCGGCCTGTTGACGATTGACAGATACTCGAGTATCTGTCAATCGTCAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks