EMAIL THIS PAGE TO A FRIEND

CCR2

chemokine (C-C motif) receptor 2

55 Gene Product Result for
Synonyms: CC-CKR-2 CCR-2 CCR2A CCR2B CD192 CKR2 CKR2A CKR2B CMKBR2 MCP-1-R
UniProtKB ID: P41597, A0AVQ3, B2RMT0, Q4VBL2
Gene ID:
Human(729230) Summary: This gene encodes two isoforms of a receptor for monocyte chemoattractant protein-1, a chemokine which specifically mediates monocyte chemotaxis. Monocyte chemoattractant protein-1 is involved in monocyte infiltration in inflammatory diseases such as rheumatoid arthritis as well as in the inflammatory response against tumors. The receptors encoded by this gene mediate agonist-dependent calcium mobilization and inhibition of adenylyl cyclase. This gene is located in the chemokine receptor gene cluster region. Two alternatively spliced transcript variants are expressed by the gene. [provided by RefSeq, Mar 2009]
Mouse(12772) chemokine (C-C motif) receptor 2
Rat(60463) chemokine (C-C motif) receptor 2
domestic guinea pig(100718888) chemokine (C-C motif) receptor 2
naked mole-rat(101724105) chemokine (C-C motif) receptor 2
sheep(101117706) chemokine (C-C motif) receptor 2
Thale Cress(816705) glycine-rich RNA-binding protein 7
chicken(420696) chemokine (C-C motif) receptor 2
dog(484790) chemokine (C-C motif) receptor 2
domestic cat(100049057) chemokine (C-C motif) receptor 2
Horse(100048936) chemokine (C-C motif) receptor 2
cow(539002) chemokine (C-C motif) receptor 2
Thale Cress(844421) cinnamoyl-CoA reductase
Thale Cress(818503) serine/threonine-protein kinase-like protein CCR2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009915 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009915 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009915 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001123041 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001123041 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001123041 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU109141 MISSION® esiRNA esiRNA human AC098613.2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001123041 Rosetta Predictions human pricing
NM_001123396 Rosetta Predictions human pricing
NM_021866 Rosetta Predictions rat pricing
NM_009915 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001123041 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327677 predicted 1000
2 SASI_Hs02_00327678 predicted 666
3 SASI_Hs02_00327679 predicted 1078
4 SASI_Hs02_00327680 predicted 698
5 SASI_Hs02_00327681 predicted 498
6 SASI_Hs02_00327682 predicted 530
7 SASI_Hs02_00327683 predicted 1022
8 SASI_Hs02_00327684 predicted 1196
9 SASI_Hs02_00327685 predicted 811
10 SASI_Hs02_00327686 predicted 1004
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001123396 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327933 predicted 1002
2 SASI_Hs02_00327934 predicted 668
3 SASI_Hs02_00327935 predicted 1071
4 SASI_Hs02_00327936 predicted 699
5 SASI_Hs02_00327937 predicted 498
6 SASI_Hs02_00327938 predicted 525
7 SASI_Hs02_00327939 predicted 1019
8 SASI_Hs02_00327940 predicted 1196
9 SASI_Hs02_00327941 predicted 802
10 SASI_Hs02_00327942 predicted 999
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021866 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066796 predicted 560
2 SASI_Rn01_00066797 predicted 551
3 SASI_Rn01_00066798 predicted 635
4 SASI_Rn01_00066799 predicted 222
5 SASI_Rn01_00066800 predicted 207
6 SASI_Rn01_00066801 predicted 807
7 SASI_Rn01_00066802 predicted 377
8 SASI_Rn01_00066803 predicted 836
9 SASI_Rn01_00066804 predicted 580
10 SASI_Rn01_00066805 predicted 590
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009915 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119075 predicted 1060
2 SASI_Mm01_00119076 predicted 238
3 SASI_Mm01_00119077 predicted 970
4 SASI_Mm01_00119078 predicted 1323
5 SASI_Mm01_00119079 predicted 348
6 SASI_Mm01_00119080 predicted 687
7 SASI_Mm01_00119082 predicted 994
8 SASI_Mm02_00317444 predicted 1293
9 SASI_Mm01_00119084 predicted 935
10 SASI_Mm02_00317445 predicted 1094
11 SASI_Mm01_00119081 predicted 693
12 SASI_Mm01_00119083 predicted 203
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009915
CCR2 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) receptor 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009915.2-1546s21c1
Sequence:CCGGACCACTGCTCATGGATATATTCTCGAGAATATATCCATGAGCAGTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009915.2-1236s21c1
Sequence:CCGGAGGTCTCGGTTGGGTTGTAAACTCGAGTTTACAACCCAACCGAGACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009915.2-348s21c1
Sequence:CCGGGCAACATGTTGGTCATTATAACTCGAGTTATAATGACCAACATGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009915.x-171s1c1
Sequence:CCGGGCATACTATCAACATCTCATTCTCGAGAATGAGATGTTGATAGTATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009915.x-714s1c1
Sequence:CCGGCCAAACAAGATGATCACCATTCTCGAGAATGGTGATCATCTTGTTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009915.x-1065s1c1
Sequence:CCGGGCTGCATTAATCCTGTCATTTCTCGAGAAATGACAGGATTAATGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009915.x-684s1c1
Sequence:CCGGCCTCTCTACCAGGAATCATATCTCGAGATATGATTCCTGGTAGAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009915
CCR2 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) receptor 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009915.2-1546s21c1
Sequence:CCGGACCACTGCTCATGGATATATTCTCGAGAATATATCCATGAGCAGTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009915.2-1236s21c1
Sequence:CCGGAGGTCTCGGTTGGGTTGTAAACTCGAGTTTACAACCCAACCGAGACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009915.2-348s21c1
Sequence:CCGGGCAACATGTTGGTCATTATAACTCGAGTTATAATGACCAACATGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009915.x-171s1c1
Sequence:CCGGGCATACTATCAACATCTCATTCTCGAGAATGAGATGTTGATAGTATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009915.x-714s1c1
Sequence:CCGGCCAAACAAGATGATCACCATTCTCGAGAATGGTGATCATCTTGTTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009915.x-1065s1c1
Sequence:CCGGGCTGCATTAATCCTGTCATTTCTCGAGAAATGACAGGATTAATGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009915.x-684s1c1
Sequence:CCGGCCTCTCTACCAGGAATCATATCTCGAGATATGATTCCTGGTAGAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009915
CCR2 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) receptor 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009915.2-1546s21c1
Sequence:CCGGACCACTGCTCATGGATATATTCTCGAGAATATATCCATGAGCAGTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009915.2-1236s21c1
Sequence:CCGGAGGTCTCGGTTGGGTTGTAAACTCGAGTTTACAACCCAACCGAGACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009915.2-348s21c1
Sequence:CCGGGCAACATGTTGGTCATTATAACTCGAGTTATAATGACCAACATGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009915.x-171s1c1
Sequence:CCGGGCATACTATCAACATCTCATTCTCGAGAATGAGATGTTGATAGTATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009915.x-714s1c1
Sequence:CCGGCCAAACAAGATGATCACCATTCTCGAGAATGGTGATCATCTTGTTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009915.x-1065s1c1
Sequence:CCGGGCTGCATTAATCCTGTCATTTCTCGAGAAATGACAGGATTAATGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009915.x-684s1c1
Sequence:CCGGCCTCTCTACCAGGAATCATATCTCGAGATATGATTCCTGGTAGAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001123041
CCR2 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) receptor 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123041.2-1046s21c1
Sequence:CCGGTTATGTCTGTGGCCCTTATTTCTCGAGAAATAAGGGCCACAGACATAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001123041.2-2173s21c1
Sequence:CCGGTTATGAAGTCATGCGTTTAATCTCGAGATTAAACGCATGACTTCATAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123041.2-838s21c1
Sequence:CCGGGGCTGTATCACATCGGTTATTCTCGAGAATAACCGATGTGATACAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123041.2-568s21c1
Sequence:CCGGACGGTGCTCCCTGTCATAAATCTCGAGATTTATGACAGGGAGCACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123041.2-1247s21c1
Sequence:CCGGCTTCTGGACTCCCTATAATATCTCGAGATATTATAGGGAGTCCAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001123041
CCR2 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) receptor 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123041.2-1046s21c1
Sequence:CCGGTTATGTCTGTGGCCCTTATTTCTCGAGAAATAAGGGCCACAGACATAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001123041.2-2173s21c1
Sequence:CCGGTTATGAAGTCATGCGTTTAATCTCGAGATTAAACGCATGACTTCATAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123041.2-838s21c1
Sequence:CCGGGGCTGTATCACATCGGTTATTCTCGAGAATAACCGATGTGATACAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123041.2-568s21c1
Sequence:CCGGACGGTGCTCCCTGTCATAAATCTCGAGATTTATGACAGGGAGCACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123041.2-1247s21c1
Sequence:CCGGCTTCTGGACTCCCTATAATATCTCGAGATATTATAGGGAGTCCAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001123041
CCR2 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) receptor 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123041.2-1046s21c1
Sequence:CCGGTTATGTCTGTGGCCCTTATTTCTCGAGAAATAAGGGCCACAGACATAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001123041.2-2173s21c1
Sequence:CCGGTTATGAAGTCATGCGTTTAATCTCGAGATTAAACGCATGACTTCATAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123041.2-838s21c1
Sequence:CCGGGGCTGTATCACATCGGTTATTCTCGAGAATAACCGATGTGATACAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123041.2-568s21c1
Sequence:CCGGACGGTGCTCCCTGTCATAAATCTCGAGATTTATGACAGGGAGCACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123041.2-1247s21c1
Sequence:CCGGCTTCTGGACTCCCTATAATATCTCGAGATATTATAGGGAGTCCAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)