EMAIL THIS PAGE TO A FRIEND

CCR3

chemokine (C-C motif) receptor 3

91 Gene Product Result for
Synonyms: CC-CKR-3 CD193 CKR3 CMKBR3
Gene ID:
Human(1232) Summary: The protein encoded by this gene is a receptor for C-C type chemokines. It belongs to family 1 of the G protein-coupled receptors. This receptor binds and responds to a variety of chemokines, including eotaxin (CCL11), eotaxin-3 (CCL26), MCP-3 (CCL7), MCP-4 (CCL13), and RANTES (CCL5). It is highly expressed in eosinophils and basophils, and is also detected in TH1 and TH2 cells, as well as in airway epithelial cells. This receptor may contribute to the accumulation and activation of eosinophils and other inflammatory cells in the allergic airway. It is also known to be an entry co-receptor for HIV-1. This gene and seven other chemokine receptor genes form a chemokine receptor gene cluster on the chromosomal region 3p21. Alternatively spliced transcript variants have been described. [provided by RefSeq, Sep 2009]
Mouse(12771) chemokine (C-C motif) receptor 3
Rat(117027) chemokine (C-C motif) receptor 3
Thale Cress(824761) CRINKLY4 related 3
cow(408018) chemokine (C-C motif) receptor 3
dog(448802) chemokine (C-C motif) receptor 3
domestic cat(100191005) chemokine (C-C motif) receptor 3
sheep(443111) chemokine (C-C motif) receptor 3
Domestic Rabbit(100189557) chemokine (C-C motif) receptor 3
naked mole-rat(101724462) chemokine (C-C motif) receptor 3
domestic guinea pig(100135496) chemokine (C-C motif) receptor 3
domestic guinea pig(100718618) chemokine (C-C motif) receptor 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001837 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001837 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001837 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009914 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009914 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009914 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU082031 MISSION® esiRNA esiRNA human CCR3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001837 Rosetta Predictions human pricing
NM_178329 Rosetta Predictions human pricing
NM_053958 Rosetta Predictions rat pricing
NM_009914 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001837 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057839 predicted 620
2 SASI_Hs01_00057840 predicted 1529
3 SASI_Hs01_00057841 predicted 1612
4 SASI_Hs01_00057842 predicted 1633
5 SASI_Hs01_00057844 predicted 1650
6 SASI_Hs01_00057845 predicted 1720
7 SASI_Hs01_00057846 predicted 1653
8 SASI_Hs01_00057847 predicted 850
9 SASI_Hs01_00057848 predicted 1637
10 SASI_Hs02_00332643 predicted 1415
11 SASI_Hs01_00057843 predicted 1534
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178329 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054352 predicted 540
2 SASI_Hs01_00054353 predicted 1454
3 SASI_Hs01_00054354 predicted 1526
4 SASI_Hs01_00054355 predicted 1557
5 SASI_Hs01_00054357 predicted 1576
6 SASI_Hs01_00054358 predicted 1645
7 SASI_Hs01_00054359 predicted 1576
8 SASI_Hs01_00054360 predicted 774
9 SASI_Hs01_00054361 predicted 1560
10 SASI_Hs02_00369636 predicted 1333
11 SASI_Hs01_00054356 predicted 1449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053958 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064962 predicted 479
2 SASI_Rn01_00064963 predicted 261
3 SASI_Rn01_00064965 predicted 437
4 SASI_Rn01_00064966 predicted 215
5 SASI_Rn01_00064967 predicted 371
6 SASI_Rn01_00064969 predicted 411
7 SASI_Rn02_00266919 predicted 252
8 SASI_Rn01_00064970 predicted 387
9 SASI_Rn02_00266920 predicted 248
10 SASI_Rn02_00266921 predicted 231
11 SASI_Rn01_00064964 predicted 341
12 SASI_Rn01_00064968 predicted 427
13 SASI_Rn01_00064971 predicted 239
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009914 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051987 predicted 477
2 SASI_Mm02_00317439 predicted 262
3 SASI_Mm02_00317440 predicted 568
4 SASI_Mm01_00051991 predicted 570
5 SASI_Mm01_00051992 predicted 665
6 SASI_Mm02_00317441 predicted 368
7 SASI_Mm02_00317442 predicted 252
8 SASI_Mm01_00051994 predicted 389
9 SASI_Mm01_00051995 predicted 1267
10 SASI_Mm02_00317443 predicted 237
11 SASI_Mm01_00051988 predicted 291
12 SASI_Mm01_00051989 predicted 300
13 SASI_Mm01_00051990 predicted 363
14 SASI_Mm01_00051993 predicted 254
15 SASI_Mm01_00051996 predicted 288
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001837
CCR3 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) receptor 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001837.2-1026s1c1
Sequence:CCGGCCACACTCTGAGAATGACCATCTCGAGATGGTCATTCTCAGAGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001837.2-1476s1c1
Sequence:CCGGGCCGGAACTCTCTATTGTGTTCTCGAGAACACAATAGAGAGTTCCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001837.2-624s1c1
Sequence:CCGGGCTCCGAATTATGACCAACATCTCGAGATGTTGGTCATAATTCGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008189    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001837.2-1701s1c1
Sequence:CCGGCGTACTCATCATCAACCCTAACTCGAGTTAGGGTTGATGATGAGTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001837.2-1192s1c1
Sequence:CCGGCCCTACAATGTGGCTATCCTTCTCGAGAAGGATAGCCACATTGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001837.3-431s21c1
Sequence:CCGGATACAGGAGGCTCCGAATTATCTCGAGATAATTCGGAGCCTCCTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001837.3-736s21c1
Sequence:CCGGTAGCAGCTCTTCCTGAATTTACTCGAGTAAATTCAGGAAGAGCTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001837.3-809s21c1
Sequence:CCGGCCCAGAGGATACAGTATATAGCTCGAGCTATATACTGTATCCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001837.3-1025s21c1
Sequence:CCGGCCTTCTCTCTTCCTATCAATCCTCGAGGATTGATAGGAAGAGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001837
CCR3 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) receptor 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001837.2-1026s1c1
Sequence:CCGGCCACACTCTGAGAATGACCATCTCGAGATGGTCATTCTCAGAGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001837.2-1476s1c1
Sequence:CCGGGCCGGAACTCTCTATTGTGTTCTCGAGAACACAATAGAGAGTTCCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001837.2-624s1c1
Sequence:CCGGGCTCCGAATTATGACCAACATCTCGAGATGTTGGTCATAATTCGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008189    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001837.2-1701s1c1
Sequence:CCGGCGTACTCATCATCAACCCTAACTCGAGTTAGGGTTGATGATGAGTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001837.2-1192s1c1
Sequence:CCGGCCCTACAATGTGGCTATCCTTCTCGAGAAGGATAGCCACATTGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001837.3-431s21c1
Sequence:CCGGATACAGGAGGCTCCGAATTATCTCGAGATAATTCGGAGCCTCCTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001837.3-736s21c1
Sequence:CCGGTAGCAGCTCTTCCTGAATTTACTCGAGTAAATTCAGGAAGAGCTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001837.3-809s21c1
Sequence:CCGGCCCAGAGGATACAGTATATAGCTCGAGCTATATACTGTATCCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001837.3-1025s21c1
Sequence:CCGGCCTTCTCTCTTCCTATCAATCCTCGAGGATTGATAGGAAGAGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001837
CCR3 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) receptor 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001837.2-1026s1c1
Sequence:CCGGCCACACTCTGAGAATGACCATCTCGAGATGGTCATTCTCAGAGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001837.2-1476s1c1
Sequence:CCGGGCCGGAACTCTCTATTGTGTTCTCGAGAACACAATAGAGAGTTCCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001837.2-624s1c1
Sequence:CCGGGCTCCGAATTATGACCAACATCTCGAGATGTTGGTCATAATTCGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008189    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001837.2-1701s1c1
Sequence:CCGGCGTACTCATCATCAACCCTAACTCGAGTTAGGGTTGATGATGAGTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001837.2-1192s1c1
Sequence:CCGGCCCTACAATGTGGCTATCCTTCTCGAGAAGGATAGCCACATTGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001837.3-431s21c1
Sequence:CCGGATACAGGAGGCTCCGAATTATCTCGAGATAATTCGGAGCCTCCTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001837.3-736s21c1
Sequence:CCGGTAGCAGCTCTTCCTGAATTTACTCGAGTAAATTCAGGAAGAGCTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001837.3-809s21c1
Sequence:CCGGCCCAGAGGATACAGTATATAGCTCGAGCTATATACTGTATCCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001837.3-1025s21c1
Sequence:CCGGCCTTCTCTCTTCCTATCAATCCTCGAGGATTGATAGGAAGAGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009914
CCR3 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) receptor 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009914.2-443s1c1
Sequence:CCGGGCCTTGTACAGCGAGATCTTTCTCGAGAAAGATCTCGCTGTACAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009914.2-1141s1c1
Sequence:CCGGGCAAGAAATCTCTGTGGTGTTCTCGAGAACACCACAGAGATTTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009914.2-691s1c1
Sequence:CCGGCCATGCTCTAAGAATGAATATCTCGAGATATTCATTCTTAGAGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009914.2-989s1c1
Sequence:CCGGCCAGTAATCTACGCCTTTGTTCTCGAGAACAAAGGCGTAGATTACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009914.2-272s1c1
Sequence:CCGGCTCATAAAGTACAGGAAGCTACTCGAGTAGCTTCCTGTACTTTATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009914
CCR3 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) receptor 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009914.2-443s1c1
Sequence:CCGGGCCTTGTACAGCGAGATCTTTCTCGAGAAAGATCTCGCTGTACAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009914.2-1141s1c1
Sequence:CCGGGCAAGAAATCTCTGTGGTGTTCTCGAGAACACCACAGAGATTTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009914.2-691s1c1
Sequence:CCGGCCATGCTCTAAGAATGAATATCTCGAGATATTCATTCTTAGAGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009914.2-989s1c1
Sequence:CCGGCCAGTAATCTACGCCTTTGTTCTCGAGAACAAAGGCGTAGATTACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009914.2-272s1c1
Sequence:CCGGCTCATAAAGTACAGGAAGCTACTCGAGTAGCTTCCTGTACTTTATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009914
CCR3 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) receptor 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009914.2-443s1c1
Sequence:CCGGGCCTTGTACAGCGAGATCTTTCTCGAGAAAGATCTCGCTGTACAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009914.2-1141s1c1
Sequence:CCGGGCAAGAAATCTCTGTGGTGTTCTCGAGAACACCACAGAGATTTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009914.2-691s1c1
Sequence:CCGGCCATGCTCTAAGAATGAATATCTCGAGATATTCATTCTTAGAGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009914.2-989s1c1
Sequence:CCGGCCAGTAATCTACGCCTTTGTTCTCGAGAACAAAGGCGTAGATTACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009914.2-272s1c1
Sequence:CCGGCTCATAAAGTACAGGAAGCTACTCGAGTAGCTTCCTGTACTTTATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks