EMAIL THIS PAGE TO A FRIEND

CCR4

chemokine (C-C motif) receptor 4

56 Gene Product Result for
Synonyms: CC-CKR-4 CD194 CKR4 CMKBR4 ChemR13 HGCN:14099 K5-5
UniProtKB ID: P51679, Q9ULY6, Q9ULY7
Gene ID:
Human(1233) Summary: The protein encoded by this gene belongs to the G-protein-coupled receptor family . It is a receptor for the CC chemokine - MIP-1, RANTES, TARC and MCP-1. Chemokines are a group of small polypeptide, structurally related molecules that regulate cell trafficking of various types of leukocytes. The chemokines also play fundamental roles in the development, homeostasis, and function of the immune system, and they have effects on cells of the central nervous system as well as on endothelial cells involved in angiogenesis or angiostasis. [provided by RefSeq, Jul 2008]
Mouse(12773) chemokine (C-C motif) receptor 4
Rat(171054) chemokine (C-C motif) receptor 4
naked mole-rat(101712312) chemokine (C-C motif) receptor 4
sheep(101105364) chemokine (C-C motif) receptor 4
Thale Cress(834836) serine/threonine-protein kinase-like protein CCR4
chicken(428457) chemokine (C-C motif) receptor 4
cow(408019) chemokine (C-C motif) receptor 4
domestic cat(101093388) chemokine (C-C motif) receptor 4
dog(403541) chemokine (C-C motif) receptor 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005508 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005508 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005508 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009916 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009916 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009916 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005508 Rosetta Predictions human pricing
NM_133532 Rosetta Predictions rat pricing
NM_009916 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005508 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043053 predicted 211
2 SASI_Hs01_00043054 predicted 932
3 SASI_Hs02_00339718 predicted 1097
4 SASI_Hs01_00043055 predicted 504
5 SASI_Hs01_00043056 predicted 1231
6 SASI_Hs01_00043057 predicted 194
7 SASI_Hs01_00043058 predicted 493
8 SASI_Hs01_00043059 predicted 208
9 SASI_Hs01_00043060 predicted 576
10 SASI_Hs01_00043061 predicted 682
11 SASI_Hs01_00043052 predicted 1219
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133532 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047748 predicted 242
2 SASI_Rn01_00047749 predicted 325
3 SASI_Rn02_00267713 predicted 316
4 SASI_Rn01_00047751 predicted 216
5 SASI_Rn01_00047752 predicted 341
6 SASI_Rn01_00047753 predicted 792
7 SASI_Rn01_00047754 predicted 536
8 SASI_Rn01_00047755 predicted 823
9 SASI_Rn01_00047756 predicted 200
10 SASI_Rn02_00267714 predicted 357
11 SASI_Rn01_00047750 predicted 321
12 SASI_Rn01_00047757 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009916 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067084 predicted 1033
2 SASI_Mm02_00317446 predicted 1025
3 SASI_Mm01_00067086 predicted 435
4 SASI_Mm01_00067087 predicted 1094
5 SASI_Mm01_00067088 predicted 228
6 SASI_Mm01_00067089 predicted 445
7 SASI_Mm01_00067090 predicted 569
8 SASI_Mm01_00067091 predicted 351
9 SASI_Mm01_00067092 predicted 384
10 SASI_Mm01_00067093 predicted 525
11 SASI_Mm01_00067085 predicted 201
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005508
CCR4 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) receptor 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005508.4-773s21c1
Sequence:CCGGGCTCCCTGGAAATCAACATTCCTCGAGGAATGTTGATTTCCAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005508.4-196s21c1
Sequence:CCGGACCCTCGATGAAAGCATATACCTCGAGGTATATGCTTTCATCGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005508.4-347s21c1
Sequence:CCGGTGGTTCTGGTCCTGTTCAAATCTCGAGATTTGAACAGGACCAGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005508.4-847s21c1
Sequence:CCGGAGGACCTTGCAGCATTGTAAACTCGAGTTTACAATGCTGCAAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008194    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005508.3-1288s1c1
Sequence:CCGGGAGTCAATGAACTTTCCACATCTCGAGATGTGGAAAGTTCATTGACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005508.3-1013s1c1
Sequence:CCGGCTTTGAAAGATACTTGGACTACTCGAGTAGTCCAAGTATCTTTCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005508.3-697s1c1
Sequence:CCGGGCTTTCTGTTCAGCACTTGTTCTCGAGAACAAGTGCTGAACAGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005508.3-822s1c1
Sequence:CCGGCCCTTAGGGATCATGCTGTTTCTCGAGAAACAGCATGATCCCTAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005508.3-215s1c1
Sequence:CCGGCGATGAAAGCATATACAGCAACTCGAGTTGCTGTATATGCTTTCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005508
CCR4 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) receptor 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005508.4-773s21c1
Sequence:CCGGGCTCCCTGGAAATCAACATTCCTCGAGGAATGTTGATTTCCAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005508.4-196s21c1
Sequence:CCGGACCCTCGATGAAAGCATATACCTCGAGGTATATGCTTTCATCGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005508.4-347s21c1
Sequence:CCGGTGGTTCTGGTCCTGTTCAAATCTCGAGATTTGAACAGGACCAGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005508.4-847s21c1
Sequence:CCGGAGGACCTTGCAGCATTGTAAACTCGAGTTTACAATGCTGCAAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008194    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005508.3-1288s1c1
Sequence:CCGGGAGTCAATGAACTTTCCACATCTCGAGATGTGGAAAGTTCATTGACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005508.3-1013s1c1
Sequence:CCGGCTTTGAAAGATACTTGGACTACTCGAGTAGTCCAAGTATCTTTCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005508.3-697s1c1
Sequence:CCGGGCTTTCTGTTCAGCACTTGTTCTCGAGAACAAGTGCTGAACAGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005508.3-822s1c1
Sequence:CCGGCCCTTAGGGATCATGCTGTTTCTCGAGAAACAGCATGATCCCTAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005508.3-215s1c1
Sequence:CCGGCGATGAAAGCATATACAGCAACTCGAGTTGCTGTATATGCTTTCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005508
CCR4 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) receptor 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005508.4-773s21c1
Sequence:CCGGGCTCCCTGGAAATCAACATTCCTCGAGGAATGTTGATTTCCAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005508.4-196s21c1
Sequence:CCGGACCCTCGATGAAAGCATATACCTCGAGGTATATGCTTTCATCGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005508.4-347s21c1
Sequence:CCGGTGGTTCTGGTCCTGTTCAAATCTCGAGATTTGAACAGGACCAGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005508.4-847s21c1
Sequence:CCGGAGGACCTTGCAGCATTGTAAACTCGAGTTTACAATGCTGCAAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008194    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005508.3-1288s1c1
Sequence:CCGGGAGTCAATGAACTTTCCACATCTCGAGATGTGGAAAGTTCATTGACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005508.3-1013s1c1
Sequence:CCGGCTTTGAAAGATACTTGGACTACTCGAGTAGTCCAAGTATCTTTCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005508.3-697s1c1
Sequence:CCGGGCTTTCTGTTCAGCACTTGTTCTCGAGAACAAGTGCTGAACAGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005508.3-822s1c1
Sequence:CCGGCCCTTAGGGATCATGCTGTTTCTCGAGAAACAGCATGATCCCTAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005508.3-215s1c1
Sequence:CCGGCGATGAAAGCATATACAGCAACTCGAGTTGCTGTATATGCTTTCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009916
CCR4 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) receptor 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009916.1-465s1c1
Sequence:CCGGCAAGATCGTTTCATGGATGTACTCGAGTACATCCATGAAACGATCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009916.1-1071s1c1
Sequence:CCGGCAAGTACATCACCCAACTCTTCTCGAGAAGAGTTGGGTGATGTACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009916.1-224s1c1
Sequence:CCGGCCAAGGAAGGTATCAAGGCATCTCGAGATGCCTTGATACCTTCCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009916.1-902s1c1
Sequence:CCGGCGCCGTACAACGTGGTGCTTTCTCGAGAAAGCACCACGTTGTACGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009916.1-1140s1c1
Sequence:CCGGCCAGGTCTACTCGGCTGACATCTCGAGATGTCAGCCGAGTAGACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009916
CCR4 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) receptor 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009916.1-465s1c1
Sequence:CCGGCAAGATCGTTTCATGGATGTACTCGAGTACATCCATGAAACGATCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009916.1-1071s1c1
Sequence:CCGGCAAGTACATCACCCAACTCTTCTCGAGAAGAGTTGGGTGATGTACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009916.1-224s1c1
Sequence:CCGGCCAAGGAAGGTATCAAGGCATCTCGAGATGCCTTGATACCTTCCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009916.1-902s1c1
Sequence:CCGGCGCCGTACAACGTGGTGCTTTCTCGAGAAAGCACCACGTTGTACGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009916.1-1140s1c1
Sequence:CCGGCCAGGTCTACTCGGCTGACATCTCGAGATGTCAGCCGAGTAGACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009916
CCR4 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) receptor 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009916.1-465s1c1
Sequence:CCGGCAAGATCGTTTCATGGATGTACTCGAGTACATCCATGAAACGATCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009916.1-1071s1c1
Sequence:CCGGCAAGTACATCACCCAACTCTTCTCGAGAAGAGTTGGGTGATGTACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009916.1-224s1c1
Sequence:CCGGCCAAGGAAGGTATCAAGGCATCTCGAGATGCCTTGATACCTTCCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009916.1-902s1c1
Sequence:CCGGCGCCGTACAACGTGGTGCTTTCTCGAGAAAGCACCACGTTGTACGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009916.1-1140s1c1
Sequence:CCGGCCAGGTCTACTCGGCTGACATCTCGAGATGTCAGCCGAGTAGACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks