EMAIL THIS PAGE TO A FRIEND

CCR5

chemokine (C-C motif) receptor 5 (gene/pseudogene)

105 Gene Product Result for
Synonyms: CC-CKR-5 CCCKR5 CCR-5 CD195 CKR-5 CKR5 CMKBR5 IDDM22
Gene ID:
Human(1234) Summary: This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. This protein is expressed by T cells and macrophages, and is known to be an important co-receptor for macrophage-tropic virus, including HIV, to enter host cells. Defective alleles of this gene have been associated with the HIV infection resistance. The ligands of this receptor include monocyte chemoattractant protein 2 (MCP-2), macrophage inflammatory protein 1 alpha (MIP-1 alpha), macrophage inflammatory protein 1 beta (MIP-1 beta) and regulated on activation normal T expressed and secreted protein (RANTES). Expression of this gene was also detected in a promyeloblastic cell line, suggesting that this protein may play a role in granulocyte lineage proliferation and differentiation. This gene is located at the chemokine receptor gene cluster region. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(12774) chemokine (C-C motif) receptor 5
Rat(117029) chemokine (C-C motif) receptor 5
chicken(420695) chemokine (C-C motif) receptor 5
dog(484789) chemokine (C-C motif) receptor 5
domestic cat(493769) chemokine (C-C motif) receptor 5
cow(497017) chemokine (C-C motif) receptor 5
Horse(100048935) chemokine (C-C motif) receptor 5
sheep(101117453) chemokine (C-C motif) receptor 5
Domestic Rabbit(100101579) chemokine (C-C motif) receptor 5
naked mole-rat(101723738) chemokine (C-C motif) receptor 5
domestic guinea pig(100716672) chemokine (C-C motif) receptor 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000579 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000579 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000579 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009917 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009917 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009917 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000579 Rosetta Predictions human pricing
NM_001100168 Rosetta Predictions human pricing
NM_053960 Rosetta Predictions rat pricing
NM_009917 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000579 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128698 predicted 1132
2 SASI_Hs02_00302841 predicted 1051
3 SASI_Hs01_00128699 predicted 661
4 SASI_Hs01_00128700 predicted 1307
5 SASI_Hs01_00128701 predicted 903
6 SASI_Hs01_00128703 predicted 645
7 SASI_Hs01_00128704 predicted 900
8 SASI_Hs01_00128705 predicted 1438
9 SASI_Hs01_00128706 predicted 932
10 SASI_Hs01_00128707 predicted 1152
11 SASI_Hs01_00128702 predicted 389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100168 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321804 predicted 902
2 SASI_Hs02_00321805 predicted 824
3 SASI_Hs02_00321806 predicted 421
4 SASI_Hs02_00321807 predicted 1075
5 SASI_Hs02_00321808 predicted 671
6 SASI_Hs02_00321809 predicted 411
7 SASI_Hs02_00321810 predicted 660
8 SASI_Hs02_00321811 predicted 1203
9 SASI_Hs02_00321812 predicted 699
10 SASI_Hs02_00321813 predicted 909
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053960 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060341 predicted 1074
2 SASI_Rn01_00060342 predicted 861
3 SASI_Rn01_00060343 predicted 654
4 SASI_Rn02_00266923 predicted 983
5 SASI_Rn01_00060344 predicted 855
6 SASI_Rn01_00060345 predicted 866
7 SASI_Rn01_00060346 predicted 1112
8 SASI_Rn01_00060347 predicted 620
9 SASI_Rn01_00060348 predicted 714
10 SASI_Rn01_00060349 predicted 389
11 SASI_Rn01_00060340 predicted 567
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009917 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039495 predicted 594
2 SASI_Mm01_00039496 predicted 912
3 SASI_Mm01_00039497 predicted 664
4 SASI_Mm01_00039498 predicted 1011
5 SASI_Mm01_00039499 predicted 885
6 SASI_Mm01_00039501 predicted 661
7 SASI_Mm01_00039502 predicted 689
8 SASI_Mm01_00039503 predicted 656
9 SASI_Mm01_00039500 predicted 887
10 SASI_Mm01_00039504 predicted 131
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000579
CCR5 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) receptor 5 (gene/pseudogene)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008199    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000579.1-2005s1c1
Sequence:CCGGGCTTCTTAAATGAGAAGGAATCTCGAGATTCCTTCTCATTTAAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000579.1-1102s1c1
Sequence:CCGGGCTCCCTACAACATTGTCCTTCTCGAGAAGGACAATGTTGTAGGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000579.1-750s1c1
Sequence:CCGGCCATGCTGTGTTTGCTTTAAACTCGAGTTTAAAGCAAACACAGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000579.1-1313s1c1
Sequence:CCGGGCTTCTGCAAATGCTGTTCTACTCGAGTAGAACAGCATTTGCAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000579.1-936s1c1
Sequence:CCGGCCAGACATTAAAGATAGTCATCTCGAGATGACTATCTTTAATGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000579
CCR5 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) receptor 5 (gene/pseudogene)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008199    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000579.1-2005s1c1
Sequence:CCGGGCTTCTTAAATGAGAAGGAATCTCGAGATTCCTTCTCATTTAAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000579.1-1102s1c1
Sequence:CCGGGCTCCCTACAACATTGTCCTTCTCGAGAAGGACAATGTTGTAGGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000579.1-750s1c1
Sequence:CCGGCCATGCTGTGTTTGCTTTAAACTCGAGTTTAAAGCAAACACAGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000579.1-1313s1c1
Sequence:CCGGGCTTCTGCAAATGCTGTTCTACTCGAGTAGAACAGCATTTGCAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000579.1-936s1c1
Sequence:CCGGCCAGACATTAAAGATAGTCATCTCGAGATGACTATCTTTAATGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000579
CCR5 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) receptor 5 (gene/pseudogene)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008199    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000579.1-2005s1c1
Sequence:CCGGGCTTCTTAAATGAGAAGGAATCTCGAGATTCCTTCTCATTTAAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000579.1-1102s1c1
Sequence:CCGGGCTCCCTACAACATTGTCCTTCTCGAGAAGGACAATGTTGTAGGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000579.1-750s1c1
Sequence:CCGGCCATGCTGTGTTTGCTTTAAACTCGAGTTTAAAGCAAACACAGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000579.1-1313s1c1
Sequence:CCGGGCTTCTGCAAATGCTGTTCTACTCGAGTAGAACAGCATTTGCAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000579.1-936s1c1
Sequence:CCGGCCAGACATTAAAGATAGTCATCTCGAGATGACTATCTTTAATGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009917
CCR5 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) receptor 5 (gene/pseudogene)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028205    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009917.2-1458s1c1
Sequence:CCGGCGGCTGTAAATATGCCTGATTCTCGAGAATCAGGCATATTTACAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009917.2-236s1c1
Sequence:CCGGCCTCATCTTGATAAGCTGCAACTCGAGTTGCAGCTTATCAAGATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009917.2-659s1c1
Sequence:CCGGCCAAACATTAAAGATGGTCATCTCGAGATGACCATCTTTAATGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009917.2-1105s1c1
Sequence:CCGGCCACAGGAGAACATGAAGTTTCTCGAGAAACTTCATGTTCTCCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009917.2-992s1c1
Sequence:CCGGCCGGAGTTATCTCTCAGTGTTCTCGAGAACACTGAGAGATAACTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009917
CCR5 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) receptor 5 (gene/pseudogene)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028205    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009917.2-1458s1c1
Sequence:CCGGCGGCTGTAAATATGCCTGATTCTCGAGAATCAGGCATATTTACAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009917.2-236s1c1
Sequence:CCGGCCTCATCTTGATAAGCTGCAACTCGAGTTGCAGCTTATCAAGATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009917.2-659s1c1
Sequence:CCGGCCAAACATTAAAGATGGTCATCTCGAGATGACCATCTTTAATGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009917.2-1105s1c1
Sequence:CCGGCCACAGGAGAACATGAAGTTTCTCGAGAAACTTCATGTTCTCCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009917.2-992s1c1
Sequence:CCGGCCGGAGTTATCTCTCAGTGTTCTCGAGAACACTGAGAGATAACTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009917
CCR5 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) receptor 5 (gene/pseudogene)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028205    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009917.2-1458s1c1
Sequence:CCGGCGGCTGTAAATATGCCTGATTCTCGAGAATCAGGCATATTTACAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009917.2-236s1c1
Sequence:CCGGCCTCATCTTGATAAGCTGCAACTCGAGTTGCAGCTTATCAAGATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009917.2-659s1c1
Sequence:CCGGCCAAACATTAAAGATGGTCATCTCGAGATGACCATCTTTAATGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009917.2-1105s1c1
Sequence:CCGGCCACAGGAGAACATGAAGTTTCTCGAGAAACTTCATGTTCTCCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009917.2-992s1c1
Sequence:CCGGCCGGAGTTATCTCTCAGTGTTCTCGAGAACACTGAGAGATAACTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks