EMAIL THIS PAGE TO A FRIEND

CCR6

chemokine (C-C motif) receptor 6

72 Gene Product Result for
Synonyms: BN-1 C-C CKR-6 CC-CKR-6 CCR-6 CD196 CKR-L3 CKRL3 CMKBR6 DCR2 DRY6 GPR29 GPRCY4 STRL22
UniProtKB ID: P51684, E1P5C6, P78553, Q92846
Gene ID:
Human(1235) Summary: This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. The gene is preferentially expressed by immature dendritic cells and memory T cells. The ligand of this receptor is macrophage inflammatory protein 3 alpha (MIP-3 alpha). This receptor has been shown to be important for B-lineage maturation and antigen-driven B-cell differentiation, and it may regulate the migration and recruitment of dentritic and T cells during inflammatory and immunological responses. Alternatively spliced transcript variants that encode the same protein have been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(12458) chemokine (C-C motif) receptor 6
Rat(308163) chemokine (C-C motif) receptor 6
domestic guinea pig(100721780) chemokine (C-C motif) receptor 6
naked mole-rat(101724124) chemokine (C-C motif) receptor 6
sheep(101115284) chemokine (C-C motif) receptor 6
chicken(769278) chemokine (C-C motif) receptor 6
cow(519716) chemokine (C-C motif) receptor 6
dog(484080) chemokine (C-C motif) receptor 6
domestic cat(101100307) chemokine (C-C motif) receptor 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009835 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009835 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009835 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031409 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031409 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031409 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004367 Rosetta Predictions human pricing
NM_031409 Rosetta Predictions human pricing
NM_001013145 Rosetta Predictions rat pricing
NM_009835 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004367 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033903 predicted 458
2 SASI_Hs02_00337434 predicted 1075
3 SASI_Hs01_00033906 predicted 1028
4 SASI_Hs02_00337435 predicted 662
5 SASI_Hs01_00033907 predicted 532
6 SASI_Hs01_00033908 predicted 575
7 SASI_Hs01_00033910 predicted 731
8 SASI_Hs01_00033911 predicted 715
9 SASI_Hs02_00337436 predicted 451
10 SASI_Hs02_00337437 predicted 732
11 SASI_Hs01_00033902 predicted 301
12 SASI_Hs01_00033904 predicted 323
13 SASI_Hs01_00033905 predicted 531
14 SASI_Hs01_00033909 predicted 278
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031409 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089230 predicted 715
2 SASI_Hs02_00358781 predicted 1339
3 SASI_Hs01_00089233 predicted 1289
4 SASI_Hs02_00358782 predicted 933
5 SASI_Hs01_00089234 predicted 792
6 SASI_Hs01_00089235 predicted 831
7 SASI_Hs01_00089237 predicted 997
8 SASI_Hs01_00089238 predicted 978
9 SASI_Hs02_00358783 predicted 711
10 SASI_Hs02_00358784 predicted 986
11 SASI_Hs01_00089229 predicted 584
12 SASI_Hs01_00089231 predicted 612
13 SASI_Hs01_00089232 predicted 816
14 SASI_Hs01_00089236 predicted 569
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013145 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030958 predicted 531
2 SASI_Rn01_00030960 predicted 306
3 SASI_Rn01_00030961 predicted 544
4 SASI_Rn01_00030962 predicted 294
5 SASI_Rn02_00200869 predicted 436
6 SASI_Rn01_00030963 predicted 358
7 SASI_Rn01_00030964 predicted 641
8 SASI_Rn01_00030965 predicted 604
9 SASI_Rn02_00200870 predicted 496
10 SASI_Rn01_00030966 predicted 487
11 SASI_Rn01_00030959 predicted 924
12 SASI_Rn01_00030967 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009835 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147950 predicted 1108
2 SASI_Mm01_00147951 predicted 837
3 SASI_Mm01_00147952 predicted 630
4 SASI_Mm01_00147953 predicted 835
5 SASI_Mm01_00147954 predicted 604
6 SASI_Mm01_00147955 predicted 697
7 SASI_Mm01_00147956 predicted 811
8 SASI_Mm01_00147957 predicted 866
9 SASI_Mm01_00147958 predicted 1258
10 SASI_Mm01_00147959 predicted 974
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009835
CCR6 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) receptor 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009835.2-1097s1c1
Sequence:CCGGCATCATCTCAAGCCCTACATTCTCGAGAATGTAGGGCTTGAGATGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009835.2-1574s1c1
Sequence:CCGGGTGTATGAGAAGGAAGAATAACTCGAGTTATTCTTCCTTCTCATACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009835.2-1506s1c1
Sequence:CCGGCCCGTGTTGTATGCGTTTATTCTCGAGAATAAACGCATACAACACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009835.2-627s1c1
Sequence:CCGGGATTATGACAACACAGAGTATCTCGAGATACTCTGTGTTGTCATAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009835.2-915s1c1
Sequence:CCGGGCACTGTGTAAACTGATGAAACTCGAGTTTCATCAGTTTACACAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009835
CCR6 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) receptor 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009835.2-1097s1c1
Sequence:CCGGCATCATCTCAAGCCCTACATTCTCGAGAATGTAGGGCTTGAGATGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009835.2-1574s1c1
Sequence:CCGGGTGTATGAGAAGGAAGAATAACTCGAGTTATTCTTCCTTCTCATACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009835.2-1506s1c1
Sequence:CCGGCCCGTGTTGTATGCGTTTATTCTCGAGAATAAACGCATACAACACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009835.2-627s1c1
Sequence:CCGGGATTATGACAACACAGAGTATCTCGAGATACTCTGTGTTGTCATAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009835.2-915s1c1
Sequence:CCGGGCACTGTGTAAACTGATGAAACTCGAGTTTCATCAGTTTACACAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009835
CCR6 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) receptor 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009835.2-1097s1c1
Sequence:CCGGCATCATCTCAAGCCCTACATTCTCGAGAATGTAGGGCTTGAGATGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009835.2-1574s1c1
Sequence:CCGGGTGTATGAGAAGGAAGAATAACTCGAGTTATTCTTCCTTCTCATACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009835.2-1506s1c1
Sequence:CCGGCCCGTGTTGTATGCGTTTATTCTCGAGAATAAACGCATACAACACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009835.2-627s1c1
Sequence:CCGGGATTATGACAACACAGAGTATCTCGAGATACTCTGTGTTGTCATAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009835.2-915s1c1
Sequence:CCGGGCACTGTGTAAACTGATGAAACTCGAGTTTCATCAGTTTACACAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031409
CCR6 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) receptor 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031409.2-2691s1c1
Sequence:CCGGCGTTTCTTTAATGTGGTTGAACTCGAGTTCAACCACATTAAAGAAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031409.2-588s1c1
Sequence:CCGGCGACTCCAGTGAAGATTATTTCTCGAGAAATAATCTTCACTGGAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031409.2-1357s1c1
Sequence:CCGGCCTCATAACATGGTCCTGCTTCTCGAGAAGCAGGACCATGTTATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031409.2-1271s1c1
Sequence:CCGGCCTTGGTGCAAGCTCAGAATTCTCGAGAATTCTGAGCTTGCACCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031409.2-823s1c1
Sequence:CCGGGCAGACATCCTCTTTGTTCTTCTCGAGAAGAACAAAGAGGATGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031409.3-801s21c1
Sequence:CCGGGGTCTATGACAGACGTCTATCCTCGAGGATAGACGTCTGTCATAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031409.3-603s21c1
Sequence:CCGGTCGACTCCAGTGAAGATTATTCTCGAGAATAATCTTCACTGGAGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031409.3-1645s21c1
Sequence:CCGGGACCAGTGAGACCGCAGATAACTCGAGTTATCTGCGGTCTCACTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031409.3-1910s21c1
Sequence:CCGGTTTGTAGCTCTAGGGTATATACTCGAGTATATACCCTAGAGCTACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031409
CCR6 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) receptor 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031409.2-2691s1c1
Sequence:CCGGCGTTTCTTTAATGTGGTTGAACTCGAGTTCAACCACATTAAAGAAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031409.2-588s1c1
Sequence:CCGGCGACTCCAGTGAAGATTATTTCTCGAGAAATAATCTTCACTGGAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031409.2-1357s1c1
Sequence:CCGGCCTCATAACATGGTCCTGCTTCTCGAGAAGCAGGACCATGTTATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031409.2-1271s1c1
Sequence:CCGGCCTTGGTGCAAGCTCAGAATTCTCGAGAATTCTGAGCTTGCACCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031409.2-823s1c1
Sequence:CCGGGCAGACATCCTCTTTGTTCTTCTCGAGAAGAACAAAGAGGATGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031409.3-801s21c1
Sequence:CCGGGGTCTATGACAGACGTCTATCCTCGAGGATAGACGTCTGTCATAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031409.3-603s21c1
Sequence:CCGGTCGACTCCAGTGAAGATTATTCTCGAGAATAATCTTCACTGGAGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031409.3-1645s21c1
Sequence:CCGGGACCAGTGAGACCGCAGATAACTCGAGTTATCTGCGGTCTCACTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031409.3-1910s21c1
Sequence:CCGGTTTGTAGCTCTAGGGTATATACTCGAGTATATACCCTAGAGCTACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031409
CCR6 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) receptor 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031409.2-2691s1c1
Sequence:CCGGCGTTTCTTTAATGTGGTTGAACTCGAGTTCAACCACATTAAAGAAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031409.2-588s1c1
Sequence:CCGGCGACTCCAGTGAAGATTATTTCTCGAGAAATAATCTTCACTGGAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031409.2-1357s1c1
Sequence:CCGGCCTCATAACATGGTCCTGCTTCTCGAGAAGCAGGACCATGTTATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031409.2-1271s1c1
Sequence:CCGGCCTTGGTGCAAGCTCAGAATTCTCGAGAATTCTGAGCTTGCACCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031409.2-823s1c1
Sequence:CCGGGCAGACATCCTCTTTGTTCTTCTCGAGAAGAACAAAGAGGATGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031409.3-801s21c1
Sequence:CCGGGGTCTATGACAGACGTCTATCCTCGAGGATAGACGTCTGTCATAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031409.3-603s21c1
Sequence:CCGGTCGACTCCAGTGAAGATTATTCTCGAGAATAATCTTCACTGGAGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031409.3-1645s21c1
Sequence:CCGGGACCAGTGAGACCGCAGATAACTCGAGTTATCTGCGGTCTCACTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031409.3-1910s21c1
Sequence:CCGGTTTGTAGCTCTAGGGTATATACTCGAGTATATACCCTAGAGCTACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks