EMAIL THIS PAGE TO A FRIEND

CCR7

chemokine (C-C motif) receptor 7

Synonyms: BLR2 CD197 CDw197 CMKBR7 EBI1
UniProtKB ID: P32248
Gene ID:
Human(1236) Summary: The protein encoded by this gene is a member of the G protein-coupled receptor family. This receptor was identified as a gene induced by the Epstein-Barr virus (EBV), and is thought to be a mediator of EBV effects on B lymphocytes. This receptor is expressed in various lymphoid tissues and activates B and T lymphocytes. It has been shown to control the migration of memory T cells to inflamed tissues, as well as stimulate dendritic cell maturation. The chemokine (C-C motif) ligand 19 (CCL19/ECL) has been reported to be a specific ligand of this receptor. [provided by RefSeq, Jul 2008]
Mouse(12775) chemokine (C-C motif) receptor 7
Rat(287673) chemokine (C-C motif) receptor 7
Zebrafish(565958) chemokine (C-C motif) receptor 7
cow(510668) chemokine (C-C motif) receptor 7
domestic cat(101084327) chemokine (C-C motif) receptor 7
dog(491011) chemokine (C-C motif) receptor 7
chicken(428315) chemokine (C-C motif) receptor 7
sheep(101109462) chemokine (C-C motif) receptor 7
naked mole-rat(101719311) chemokine (C-C motif) receptor 7
domestic guinea pig(100728690) chemokine (C-C motif) receptor 7
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001838 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001838 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001838 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007719 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007719 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007719 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001838 Rosetta Predictions human pricing
NM_199489 Rosetta Predictions rat pricing
NM_007719 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001838 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177211 predicted 291
2 SASI_Hs01_00177212 predicted 203
3 SASI_Hs01_00177213 predicted 459
4 SASI_Hs01_00177214 predicted 1393
5 SASI_Hs02_00332644 predicted 1417
6 SASI_Hs01_00177215 predicted 1461
7 SASI_Hs01_00177216 predicted 1034
8 SASI_Hs01_00177217 predicted 1675
9 SASI_Hs01_00177219 predicted 1255
10 SASI_Hs02_00332645 predicted 1656
11 SASI_Hs01_00177218 predicted 1483
12 SASI_Hs01_00177220 predicted 330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199489 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118978 predicted 480
2 SASI_Rn01_00118981 predicted 222
3 SASI_Rn02_00270248 predicted 753
4 SASI_Rn01_00118982 predicted 264
5 SASI_Rn02_00270249 predicted 777
6 SASI_Rn02_00270250 predicted 748
7 SASI_Rn02_00270251 predicted 248
8 SASI_Rn01_00118985 predicted 334
9 SASI_Rn02_00270252 predicted 729
10 SASI_Rn02_00270253 predicted 201
11 SASI_Rn01_00118976 predicted 461
12 SASI_Rn01_00118977 predicted 1325
13 SASI_Rn01_00118979 predicted 1394
14 SASI_Rn01_00118980 predicted 1391
15 SASI_Rn01_00118983 predicted 782
16 SASI_Rn01_00118984 predicted 1363
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007719 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153428 predicted 221
2 SASI_Mm01_00153429 predicted 306
3 SASI_Mm01_00153430 predicted 467
4 SASI_Mm01_00153431 predicted 435
5 SASI_Mm01_00153433 predicted 339
6 SASI_Mm01_00153434 predicted 727
7 SASI_Mm01_00153436 predicted 937
8 SASI_Mm02_00312289 predicted 657
9 SASI_Mm02_00312290 predicted 1510
10 SASI_Mm02_00312291 predicted 1287
11 SASI_Mm01_00153432 predicted 1560
12 SASI_Mm01_00153435 predicted 270
13 SASI_Mm01_00153437 predicted 267
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001838
CCR7 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) receptor 7
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001838.2-184s21c1
Sequence:CCGGTACACTTTGTTCGAGTCTTTGCTCGAGCAAAGACTCGAACAAAGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001838.2-139s21c1
Sequence:CCGGGATGAGGTCACGGACGATTACCTCGAGGTAATCGTCCGTGACCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001838.2-294s21c1
Sequence:CCGGGCTGGTCGTGTTGACCTATATCTCGAGATATAGGTCAACACGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001838.2-960s1c1
Sequence:CCGGGCTCAGTAAGCAACTCAACATCTCGAGATGTTGAGTTGCTTACTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001838.2-300s1c1
Sequence:CCGGCGTGTTGACCTATATCTATTTCTCGAGAAATAGATATAGGTCAACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001838.2-1029s1c1
Sequence:CCGGCCCTTTCTTGTACGCCTTCATCTCGAGATGAAGGCGTACAAGAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001838.2-246s1c1
Sequence:CCGGCCCTATCATGTACTCCATCATCTCGAGATGATGGAGTACATGATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001838.2-2007s1c1
Sequence:CCGGCGAGCTTGTTCTTTGTTCTTTCTCGAGAAAGAACAAAGAACAAGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001838
CCR7 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) receptor 7
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001838.2-184s21c1
Sequence:CCGGTACACTTTGTTCGAGTCTTTGCTCGAGCAAAGACTCGAACAAAGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001838.2-139s21c1
Sequence:CCGGGATGAGGTCACGGACGATTACCTCGAGGTAATCGTCCGTGACCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001838.2-294s21c1
Sequence:CCGGGCTGGTCGTGTTGACCTATATCTCGAGATATAGGTCAACACGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001838.2-960s1c1
Sequence:CCGGGCTCAGTAAGCAACTCAACATCTCGAGATGTTGAGTTGCTTACTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001838.2-300s1c1
Sequence:CCGGCGTGTTGACCTATATCTATTTCTCGAGAAATAGATATAGGTCAACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001838.2-1029s1c1
Sequence:CCGGCCCTTTCTTGTACGCCTTCATCTCGAGATGAAGGCGTACAAGAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001838.2-246s1c1
Sequence:CCGGCCCTATCATGTACTCCATCATCTCGAGATGATGGAGTACATGATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001838.2-2007s1c1
Sequence:CCGGCGAGCTTGTTCTTTGTTCTTTCTCGAGAAAGAACAAAGAACAAGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001838
CCR7 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) receptor 7
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001838.2-184s21c1
Sequence:CCGGTACACTTTGTTCGAGTCTTTGCTCGAGCAAAGACTCGAACAAAGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001838.2-139s21c1
Sequence:CCGGGATGAGGTCACGGACGATTACCTCGAGGTAATCGTCCGTGACCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001838.2-294s21c1
Sequence:CCGGGCTGGTCGTGTTGACCTATATCTCGAGATATAGGTCAACACGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001838.2-960s1c1
Sequence:CCGGGCTCAGTAAGCAACTCAACATCTCGAGATGTTGAGTTGCTTACTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001838.2-300s1c1
Sequence:CCGGCGTGTTGACCTATATCTATTTCTCGAGAAATAGATATAGGTCAACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001838.2-1029s1c1
Sequence:CCGGCCCTTTCTTGTACGCCTTCATCTCGAGATGAAGGCGTACAAGAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001838.2-246s1c1
Sequence:CCGGCCCTATCATGTACTCCATCATCTCGAGATGATGGAGTACATGATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001838.2-2007s1c1
Sequence:CCGGCGAGCTTGTTCTTTGTTCTTTCTCGAGAAAGAACAAAGAACAAGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007719
CCR7 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) receptor 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007719.1-263s1c1
Sequence:CCGGGATGACTACATCGGCGAGAATCTCGAGATTCTCGCCGATGTAGTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007719.1-358s1c1
Sequence:CCGGGCCTCTCATGTATTCTGTCATCTCGAGATGACAGAATACATGAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007719.1-904s1c1
Sequence:CCGGCCTCATTATCATCCGTACCTTCTCGAGAAGGTACGGATGATAATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007719.1-1141s1c1
Sequence:CCGGCCCTTTCTTGTATGCCTTCATCTCGAGATGAAGGCATACAAGAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007719.1-564s1c1
Sequence:CCGGAGGGCATCTTTGGCATCTATACTCGAGTATAGATGCCAAAGATGCCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007719
CCR7 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) receptor 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007719.1-263s1c1
Sequence:CCGGGATGACTACATCGGCGAGAATCTCGAGATTCTCGCCGATGTAGTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007719.1-358s1c1
Sequence:CCGGGCCTCTCATGTATTCTGTCATCTCGAGATGACAGAATACATGAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007719.1-904s1c1
Sequence:CCGGCCTCATTATCATCCGTACCTTCTCGAGAAGGTACGGATGATAATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007719.1-1141s1c1
Sequence:CCGGCCCTTTCTTGTATGCCTTCATCTCGAGATGAAGGCATACAAGAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007719.1-564s1c1
Sequence:CCGGAGGGCATCTTTGGCATCTATACTCGAGTATAGATGCCAAAGATGCCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007719
CCR7 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) receptor 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007719.1-263s1c1
Sequence:CCGGGATGACTACATCGGCGAGAATCTCGAGATTCTCGCCGATGTAGTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007719.1-358s1c1
Sequence:CCGGGCCTCTCATGTATTCTGTCATCTCGAGATGACAGAATACATGAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007719.1-904s1c1
Sequence:CCGGCCTCATTATCATCCGTACCTTCTCGAGAAGGTACGGATGATAATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007719.1-1141s1c1
Sequence:CCGGCCCTTTCTTGTATGCCTTCATCTCGAGATGAAGGCATACAAGAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007719.1-564s1c1
Sequence:CCGGAGGGCATCTTTGGCATCTATACTCGAGTATAGATGCCAAAGATGCCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks