EMAIL THIS PAGE TO A FRIEND

CCR8

chemokine (C-C motif) receptor 8

64 Gene Product Result for
Synonyms: CC-CKR-8 CCR-8 CDw198 CKRL1 CMKBR8 CMKBRL2 CY6 GPRCY6 TER1
UniProtKB ID: P51685, B2RC64, Q3KNQ8, Q9BYX5
Gene ID:
Human(1237) Summary: This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. Chemokines and their receptors are important for the migration of various cell types into the inflammatory sites. This receptor protein preferentially expresses in the thymus. I-309, thymus activation-regulated cytokine (TARC) and macrophage inflammatory protein-1 beta (MIP-1 beta) have been identified as ligands of this receptor. Studies of this receptor and its ligands suggested its role in regulation of monocyte chemotaxis and thymic cell apoptosis. More specifically, this receptor may contribute to the proper positioning of activated T cells within the antigenic challenge sites and specialized areas of lymphoid tissues. This gene is located at the chemokine receptor gene cluster region. [provided by RefSeq, Jul 2008]
Mouse(12776) chemokine (C-C motif) receptor 8
Rat(301066) chemokine (C-C motif) receptor 8
domestic guinea pig(100725278) chemokine (C-C motif) receptor 8
naked mole-rat(101706054) chemokine (C-C motif) receptor 8
sheep(101113281) chemokine (C-C motif) receptor 8
chicken(420718) chemokine (C-C motif) receptor 8
domestic cat(101099650) chemokine (C-C motif) receptor 8
dog(485600) chemokine (C-C motif) receptor 8
cow(407772) chemokine (C-C motif) receptor 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007720 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007720 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007720 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005201 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005201 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005201 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005201 Rosetta Predictions human pricing
XM_001077746 Rosetta Predictions rat pricing
XM_236704 Rosetta Predictions rat pricing
NM_007720 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005201 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044894 predicted 215
2 SASI_Hs01_00044895 predicted 534
3 SASI_Hs01_00044896 predicted 200
4 SASI_Hs01_00044897 predicted 416
5 SASI_Hs01_00044898 predicted 466
6 SASI_Hs01_00044899 predicted 836
7 SASI_Hs02_00339170 predicted 465
8 SASI_Hs01_00044902 predicted 429
9 SASI_Hs01_00044903 predicted 844
10 SASI_Hs02_00339171 predicted 914
11 SASI_Hs01_00044900 predicted 923
12 SASI_Hs01_00044901 predicted 643
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077746 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00358331 predicted 778
2 SASI_Rn02_00358332 predicted 227
3 SASI_Rn02_00358333 predicted 226
4 SASI_Rn02_00358334 predicted 235
5 SASI_Rn02_00358335 predicted 344
6 SASI_Rn02_00358336 predicted 813
7 SASI_Rn02_00358337 predicted 572
8 SASI_Rn02_00358338 predicted 773
9 SASI_Rn02_00358339 predicted 692
10 SASI_Rn02_00358340 predicted 311
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236704 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390359 predicted 779
2 SASI_Rn02_00390360 predicted 230
3 SASI_Rn02_00390361 predicted 231
4 SASI_Rn02_00390362 predicted 243
5 SASI_Rn02_00390363 predicted 352
6 SASI_Rn02_00390364 predicted 807
7 SASI_Rn02_00390365 predicted 581
8 SASI_Rn02_00390366 predicted 774
9 SASI_Rn02_00390367 predicted 692
10 SASI_Rn02_00390368 predicted 309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007720 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105912 predicted 355
2 SASI_Mm01_00105913 predicted 904
3 SASI_Mm01_00105915 predicted 689
4 SASI_Mm01_00105916 predicted 702
5 SASI_Mm01_00105917 predicted 783
6 SASI_Mm01_00105918 predicted 770
7 SASI_Mm01_00105919 predicted 304
8 SASI_Mm01_00105920 predicted 382
9 SASI_Mm01_00105921 predicted 641
10 SASI_Mm02_00312292 predicted 415
11 SASI_Mm01_00105914 predicted 825
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007720
CCR8 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) receptor 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007720.1-602s1c1
Sequence:CCGGCCACTTTGAAATCAACGCCTTCTCGAGAAGGCGTTGATTTCAAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007720.1-408s1c1
Sequence:CCGGGCTATTGTCCACGCTGTCTATCTCGAGATAGACAGCGTGGACAATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007720.1-50s1c1
Sequence:CCGGCGACTACTACCCTGATTTCTTCTCGAGAAGAAATCAGGGTAGTAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007720.1-908s1c1
Sequence:CCGGCGCGTTCATAGGAGAGAAGTTCTCGAGAACTTCTCTCCTATGAACGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007720.1-125s1c1
Sequence:CCGGCATCTTGTACTGCGTCTTGTTCTCGAGAACAAGACGCAGTACAAGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007720
CCR8 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) receptor 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007720.1-602s1c1
Sequence:CCGGCCACTTTGAAATCAACGCCTTCTCGAGAAGGCGTTGATTTCAAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007720.1-408s1c1
Sequence:CCGGGCTATTGTCCACGCTGTCTATCTCGAGATAGACAGCGTGGACAATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007720.1-50s1c1
Sequence:CCGGCGACTACTACCCTGATTTCTTCTCGAGAAGAAATCAGGGTAGTAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007720.1-908s1c1
Sequence:CCGGCGCGTTCATAGGAGAGAAGTTCTCGAGAACTTCTCTCCTATGAACGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007720.1-125s1c1
Sequence:CCGGCATCTTGTACTGCGTCTTGTTCTCGAGAACAAGACGCAGTACAAGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007720
CCR8 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) receptor 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007720.1-602s1c1
Sequence:CCGGCCACTTTGAAATCAACGCCTTCTCGAGAAGGCGTTGATTTCAAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007720.1-408s1c1
Sequence:CCGGGCTATTGTCCACGCTGTCTATCTCGAGATAGACAGCGTGGACAATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007720.1-50s1c1
Sequence:CCGGCGACTACTACCCTGATTTCTTCTCGAGAAGAAATCAGGGTAGTAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007720.1-908s1c1
Sequence:CCGGCGCGTTCATAGGAGAGAAGTTCTCGAGAACTTCTCTCCTATGAACGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007720.1-125s1c1
Sequence:CCGGCATCTTGTACTGCGTCTTGTTCTCGAGAACAAGACGCAGTACAAGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005201
CCR8 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) receptor 8
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008214    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005201.2-2153s1c1
Sequence:CCGGCGTGTGAGTAAGTGTAAGAAACTCGAGTTTCTTACACTTACTCACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005201.2-874s1c1
Sequence:CCGGGTCCCATTCAACGTGGTTCTTCTCGAGAAGAACCACGTTGAATGGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005201.2-190s1c1
Sequence:CCGGCCCTGTGATGCGGAACTTATTCTCGAGAATAAGTTCCGCATCACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005201.2-159s1c1
Sequence:CCGGCGACTACTACTACCCTGATATCTCGAGATATCAGGGTAGTAGTAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005201.2-1163s1c1
Sequence:CCGGCCTCCAGCGTAGACTACATTTCTCGAGAAATGTAGTCTACGCTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005201.3-547s21c1
Sequence:CCGGCATGCCGTGTATGCCCTAAAGCTCGAGCTTTAGGGCATACACGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356756    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005201.3-1305s21c1
Sequence:CCGGGCATGAAGGATGCCATATATGCTCGAGCATATATGGCATCCTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005201.3-862s21c1
Sequence:CCGGATTGTGGTCATTGCATCTTTACTCGAGTAAAGATGCAATGACCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005201
CCR8 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) receptor 8
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008214    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005201.2-2153s1c1
Sequence:CCGGCGTGTGAGTAAGTGTAAGAAACTCGAGTTTCTTACACTTACTCACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005201.2-874s1c1
Sequence:CCGGGTCCCATTCAACGTGGTTCTTCTCGAGAAGAACCACGTTGAATGGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005201.2-190s1c1
Sequence:CCGGCCCTGTGATGCGGAACTTATTCTCGAGAATAAGTTCCGCATCACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005201.2-159s1c1
Sequence:CCGGCGACTACTACTACCCTGATATCTCGAGATATCAGGGTAGTAGTAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005201.2-1163s1c1
Sequence:CCGGCCTCCAGCGTAGACTACATTTCTCGAGAAATGTAGTCTACGCTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005201.3-547s21c1
Sequence:CCGGCATGCCGTGTATGCCCTAAAGCTCGAGCTTTAGGGCATACACGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356756    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005201.3-1305s21c1
Sequence:CCGGGCATGAAGGATGCCATATATGCTCGAGCATATATGGCATCCTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005201.3-862s21c1
Sequence:CCGGATTGTGGTCATTGCATCTTTACTCGAGTAAAGATGCAATGACCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005201
CCR8 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) receptor 8
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008214    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005201.2-2153s1c1
Sequence:CCGGCGTGTGAGTAAGTGTAAGAAACTCGAGTTTCTTACACTTACTCACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005201.2-874s1c1
Sequence:CCGGGTCCCATTCAACGTGGTTCTTCTCGAGAAGAACCACGTTGAATGGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005201.2-190s1c1
Sequence:CCGGCCCTGTGATGCGGAACTTATTCTCGAGAATAAGTTCCGCATCACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005201.2-159s1c1
Sequence:CCGGCGACTACTACTACCCTGATATCTCGAGATATCAGGGTAGTAGTAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005201.2-1163s1c1
Sequence:CCGGCCTCCAGCGTAGACTACATTTCTCGAGAAATGTAGTCTACGCTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005201.3-547s21c1
Sequence:CCGGCATGCCGTGTATGCCCTAAAGCTCGAGCTTTAGGGCATACACGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356756    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005201.3-1305s21c1
Sequence:CCGGGCATGAAGGATGCCATATATGCTCGAGCATATATGGCATCCTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005201.3-862s21c1
Sequence:CCGGATTGTGGTCATTGCATCTTTACTCGAGTAAAGATGCAATGACCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks