EMAIL THIS PAGE TO A FRIEND

CCR9

chemokine (C-C motif) receptor 9

75 Gene Product Result for
Synonyms: CC-CKR-9 CDw199 GPR-9-6 GPR28
UniProtKB ID: P51686, Q4VBM3, Q549E0, Q9UQQ6
Gene ID:
Human(10803) Summary: The protein encoded by this gene is a member of the beta chemokine receptor family. It is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. Chemokines and their receptors are key regulators of the thymocytes migration and maturation in normal and inflammation conditions. The specific ligand of this receptor is CCL25. It has been found that this gene is differentially expressed by T lymphocytes of small intestine and colon, suggested a role in the thymocytes recruitment and development that may permit functional specialization of immune responses in different segment of the gastrointestinal tract. This gene is mapped to the chemokine receptor gene cluster region. Two alternatively spliced transcript variants have been described. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
Mouse(12769) chemokine (C-C motif) receptor 9
Rat(282832) chemokine (C-C motif) receptor 9
chicken(428454) chemokine (C-C motif) receptor 9
cow(530951) chemokine (C-C motif) receptor 9
Horse(100065535) chemokine (C-C motif) receptor 9
domestic cat(101083247) chemokine (C-C motif) receptor 9
dog(484793) chemokine (C-C motif) receptor 9
sheep(678667) chemokine (C-C motif) receptor 9
Domestic Rabbit(100144329) chemokine (C-C motif) receptor 9
naked mole-rat(101721877) chemokine (C-C motif) receptor 9
domestic guinea pig(100715542) chemokine (C-C motif) receptor 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031200 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031200 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031200 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009913 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009913 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009913 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006641 Rosetta Predictions human pricing
NM_031200 Rosetta Predictions human pricing
NM_172329 Rosetta Predictions rat pricing
NM_009913 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006641 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070293 predicted 710
2 SASI_Hs01_00070294 predicted 1104
3 SASI_Hs01_00070295 predicted 338
4 SASI_Hs01_00070296 predicted 645
5 SASI_Hs01_00070297 predicted 866
6 SASI_Hs01_00070298 predicted 905
7 SASI_Hs01_00070299 predicted 671
8 SASI_Hs01_00070300 predicted 305
9 SASI_Hs01_00070301 predicted 953
10 SASI_Hs02_00342003 predicted 853
11 SASI_Hs01_00070302 predicted 581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031200 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098226 predicted 795
2 SASI_Hs01_00098227 predicted 1180
3 SASI_Hs01_00098228 predicted 423
4 SASI_Hs01_00098229 predicted 719
5 SASI_Hs01_00098230 predicted 951
6 SASI_Hs01_00098231 predicted 989
7 SASI_Hs01_00098232 predicted 747
8 SASI_Hs01_00098233 predicted 386
9 SASI_Hs01_00098234 predicted 1028
10 SASI_Hs02_00358602 predicted 941
11 SASI_Hs01_00098235 predicted 661
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172329 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099389 predicted 468
2 SASI_Rn01_00099390 predicted 974
3 SASI_Rn02_00269219 predicted 874
4 SASI_Rn01_00099391 predicted 710
5 SASI_Rn02_00269220 predicted 967
6 SASI_Rn01_00099393 predicted 1152
7 SASI_Rn01_00099394 predicted 1214
8 SASI_Rn01_00099395 predicted 243
9 SASI_Rn01_00099396 predicted 643
10 SASI_Rn01_00099397 predicted 1095
11 SASI_Rn01_00099392 predicted 809
12 SASI_Rn01_00099398 predicted 468
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009913 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317434 predicted 1461
2 SASI_Mm01_00131799 predicted 1162
3 SASI_Mm01_00131802 predicted 310
4 SASI_Mm02_00317435 predicted 311
5 SASI_Mm01_00131806 predicted 1401
6 SASI_Mm01_00131807 predicted 1284
7 SASI_Mm01_00131808 predicted 647
8 SASI_Mm02_00317436 predicted 504
9 SASI_Mm02_00317437 predicted 722
10 SASI_Mm02_00317438 predicted 1153
11 SASI_Mm01_00131800 predicted 524
12 SASI_Mm01_00131801 predicted 1463
13 SASI_Mm01_00131803 predicted 841
14 SASI_Mm01_00131804 predicted 1354
15 SASI_Mm01_00131805 predicted 1448
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031200
CCR9 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) receptor 9
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031200.1-1023s21c1
Sequence:CCGGGTGCCGTTTCCACCAACATTGCTCGAGCAATGTTGGTGGAAACGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031200.1-1746s21c1
Sequence:CCGGTAACCCATGCCAGGTCTTATACTCGAGTATAAGACCTGGCATGGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356759    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031200.1-1376s21c1
Sequence:CCGGGGGATGAATCTGAACTATATGCTCGAGCATATAGTTCAGATTCATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031200.1-576s21c1
Sequence:CCGGTCAGCGTGGACAGGTACATTGCTCGAGCAATGTACCTGTCCACGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008219    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031200.1-2180s1c1
Sequence:CCGGCCCACTTTATTCTGAGGAATACTCGAGTATTCCTCAGAATAAAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031200.1-198s1c1
Sequence:CCGGCTGATGACTATGGCTCTGAATCTCGAGATTCAGAGCCATAGTCATCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031200.1-355s1c1
Sequence:CCGGCAGTCTTGTTATCCTTGTCTACTCGAGTAGACAAGGATAACAAGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031200.1-769s1c1
Sequence:CCGGCGATGAGAGCACCAAACTGAACTCGAGTTCAGTTTGGTGCTCTCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031200.1-701s1c1
Sequence:CCGGCCAGAAATCTTATACAGCCAACTCGAGTTGGCTGTATAAGATTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031200
CCR9 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) receptor 9
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031200.1-1023s21c1
Sequence:CCGGGTGCCGTTTCCACCAACATTGCTCGAGCAATGTTGGTGGAAACGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031200.1-1746s21c1
Sequence:CCGGTAACCCATGCCAGGTCTTATACTCGAGTATAAGACCTGGCATGGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356759    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031200.1-1376s21c1
Sequence:CCGGGGGATGAATCTGAACTATATGCTCGAGCATATAGTTCAGATTCATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031200.1-576s21c1
Sequence:CCGGTCAGCGTGGACAGGTACATTGCTCGAGCAATGTACCTGTCCACGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008219    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031200.1-2180s1c1
Sequence:CCGGCCCACTTTATTCTGAGGAATACTCGAGTATTCCTCAGAATAAAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031200.1-198s1c1
Sequence:CCGGCTGATGACTATGGCTCTGAATCTCGAGATTCAGAGCCATAGTCATCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031200.1-355s1c1
Sequence:CCGGCAGTCTTGTTATCCTTGTCTACTCGAGTAGACAAGGATAACAAGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031200.1-769s1c1
Sequence:CCGGCGATGAGAGCACCAAACTGAACTCGAGTTCAGTTTGGTGCTCTCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031200.1-701s1c1
Sequence:CCGGCCAGAAATCTTATACAGCCAACTCGAGTTGGCTGTATAAGATTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031200
CCR9 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) receptor 9
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031200.1-1023s21c1
Sequence:CCGGGTGCCGTTTCCACCAACATTGCTCGAGCAATGTTGGTGGAAACGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031200.1-1746s21c1
Sequence:CCGGTAACCCATGCCAGGTCTTATACTCGAGTATAAGACCTGGCATGGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356759    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031200.1-1376s21c1
Sequence:CCGGGGGATGAATCTGAACTATATGCTCGAGCATATAGTTCAGATTCATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031200.1-576s21c1
Sequence:CCGGTCAGCGTGGACAGGTACATTGCTCGAGCAATGTACCTGTCCACGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008219    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031200.1-2180s1c1
Sequence:CCGGCCCACTTTATTCTGAGGAATACTCGAGTATTCCTCAGAATAAAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031200.1-198s1c1
Sequence:CCGGCTGATGACTATGGCTCTGAATCTCGAGATTCAGAGCCATAGTCATCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031200.1-355s1c1
Sequence:CCGGCAGTCTTGTTATCCTTGTCTACTCGAGTAGACAAGGATAACAAGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031200.1-769s1c1
Sequence:CCGGCGATGAGAGCACCAAACTGAACTCGAGTTCAGTTTGGTGCTCTCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031200.1-701s1c1
Sequence:CCGGCCAGAAATCTTATACAGCCAACTCGAGTTGGCTGTATAAGATTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009913
CCR9 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) receptor 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028024    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009913.2-2358s1c1
Sequence:CCGGCCCAACAGTTTACAACCTTTACTCGAGTAAAGGTTGTAAACTGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009913.2-366s1c1
Sequence:CCGGCCACAGATGACTACATGAATTCTCGAGAATTCATGTAGTCATCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009913.2-901s1c1
Sequence:CCGGCCCTAAGGATAAGAATGCCAACTCGAGTTGGCATTCTTATCCTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009913.2-1159s1c1
Sequence:CCGGCTGCACTATTTCCACCAATATCTCGAGATATTGGTGGAAATAGTGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009913.2-1317s1c1
Sequence:CCGGCCCAGTGGGTTTCATTCACAACTCGAGTTGTGAATGAAACCCACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009913
CCR9 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) receptor 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028024    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009913.2-2358s1c1
Sequence:CCGGCCCAACAGTTTACAACCTTTACTCGAGTAAAGGTTGTAAACTGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009913.2-366s1c1
Sequence:CCGGCCACAGATGACTACATGAATTCTCGAGAATTCATGTAGTCATCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009913.2-901s1c1
Sequence:CCGGCCCTAAGGATAAGAATGCCAACTCGAGTTGGCATTCTTATCCTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009913.2-1159s1c1
Sequence:CCGGCTGCACTATTTCCACCAATATCTCGAGATATTGGTGGAAATAGTGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009913.2-1317s1c1
Sequence:CCGGCCCAGTGGGTTTCATTCACAACTCGAGTTGTGAATGAAACCCACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009913
CCR9 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) receptor 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028024    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009913.2-2358s1c1
Sequence:CCGGCCCAACAGTTTACAACCTTTACTCGAGTAAAGGTTGTAAACTGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009913.2-366s1c1
Sequence:CCGGCCACAGATGACTACATGAATTCTCGAGAATTCATGTAGTCATCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009913.2-901s1c1
Sequence:CCGGCCCTAAGGATAAGAATGCCAACTCGAGTTGGCATTCTTATCCTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009913.2-1159s1c1
Sequence:CCGGCTGCACTATTTCCACCAATATCTCGAGATATTGGTGGAAATAGTGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009913.2-1317s1c1
Sequence:CCGGCCCAGTGGGTTTCATTCACAACTCGAGTTGTGAATGAAACCCACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks