EMAIL THIS PAGE TO A FRIEND

CCRL2

chemokine (C-C motif) receptor-like 2

83 Gene Product Result for
Synonyms: ACKR5 CKRX CRAM CRAM-A CRAM-B HCR
Gene ID:
Human(9034) Summary: This gene encodes a chemokine receptor like protein, which is predicted to be a seven transmembrane protein and most closely related to CCR1. Chemokines and their receptors mediated signal transduction are critical for the recruitment of effector immune cells to the site of inflammation. This gene is expressed at high levels in primary neutrophils and primary monocytes, and is further upregulated on neutrophil activation and during monocyte to macrophage differentiation. The function of this gene is unknown. This gene is mapped to the region where the chemokine receptor gene cluster is located. [provided by RefSeq, Jul 2008]
Mouse(54199) chemokine (C-C motif) receptor-like 2
Rat(316019) chemokine (C-C motif) receptor-like 2
dog(484788) chemokine (C-C motif) receptor-like 2
naked mole-rat(101722915) chemokine (C-C motif) receptor-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017466 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_017466 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_017466 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003965 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003965 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003965 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU227131 MISSION® esiRNA esiRNA targeting human CCRL2 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003965 Rosetta Predictions human pricing
NM_001108191 Rosetta Predictions rat pricing
NM_017466 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003965 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020162 predicted 772
2 SASI_Hs01_00020165 predicted 281
3 SASI_Hs01_00020166 predicted 774
4 SASI_Hs01_00020167 predicted 1185
5 SASI_Hs01_00020168 predicted 1178
6 SASI_Hs01_00020170 predicted 1025
7 SASI_Hs01_00020171 predicted 443
8 SASI_Hs02_00336640 predicted 1203
9 SASI_Hs02_00336641 predicted 753
10 SASI_Hs02_00336642 predicted 1186
11 SASI_Hs01_00020163 predicted 511
12 SASI_Hs01_00020164 predicted 424
13 SASI_Hs01_00020169 predicted 814
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108191 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236224 predicted 1562
2 SASI_Rn02_00236225 predicted 1468
3 SASI_Rn02_00236226 predicted 678
4 SASI_Rn02_00236227 predicted 1077
5 SASI_Rn02_00236228 predicted 669
6 SASI_Rn02_00236229 predicted 1402
7 SASI_Rn02_00236230 predicted 1179
8 SASI_Rn02_00236231 predicted 820
9 SASI_Rn02_00236232 predicted 815
10 SASI_Rn02_00236233 predicted 962
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017466 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186915 predicted 555
2 SASI_Mm01_00186916 predicted 1552
3 SASI_Mm01_00186917 predicted 858
4 SASI_Mm01_00186918 predicted 636
5 SASI_Mm01_00186919 predicted 1108
6 SASI_Mm01_00186920 predicted 1565
7 SASI_Mm01_00186921 predicted 831
8 SASI_Mm02_00323929 predicted 1217
9 SASI_Mm01_00186922 predicted 864
10 SASI_Mm01_00186923 predicted 1360
11 SASI_Mm01_00186924 predicted 1083
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017466
CCRL2 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) receptor-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017466.3-690s1c1
Sequence:CCGGCGGTGTTTATCTTGGTGAAATCTCGAGATTTCACCAAGATAAACACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017466.3-1085s1c1
Sequence:CCGGCCTCACTTCTTGCCAATCGAACTCGAGTTCGATTGGCAAGAAGTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017466.3-1553s1c1
Sequence:CCGGCCCATTGAACTGTACAGCAATCTCGAGATTGCTGTACAGTTCAATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028166    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017466.3-1826s1c1
Sequence:CCGGGCTCGGTAGTTGTCCAAAGTTCTCGAGAACTTTGGACAACTACCGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017466.3-1418s1c1
Sequence:CCGGCCGCTGCTCTATTTGCTTCTTCTCGAGAAGAAGCAAATAGAGCAGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017466
CCRL2 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) receptor-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017466.3-690s1c1
Sequence:CCGGCGGTGTTTATCTTGGTGAAATCTCGAGATTTCACCAAGATAAACACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017466.3-1085s1c1
Sequence:CCGGCCTCACTTCTTGCCAATCGAACTCGAGTTCGATTGGCAAGAAGTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017466.3-1553s1c1
Sequence:CCGGCCCATTGAACTGTACAGCAATCTCGAGATTGCTGTACAGTTCAATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028166    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017466.3-1826s1c1
Sequence:CCGGGCTCGGTAGTTGTCCAAAGTTCTCGAGAACTTTGGACAACTACCGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017466.3-1418s1c1
Sequence:CCGGCCGCTGCTCTATTTGCTTCTTCTCGAGAAGAAGCAAATAGAGCAGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017466
CCRL2 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) receptor-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017466.3-690s1c1
Sequence:CCGGCGGTGTTTATCTTGGTGAAATCTCGAGATTTCACCAAGATAAACACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017466.3-1085s1c1
Sequence:CCGGCCTCACTTCTTGCCAATCGAACTCGAGTTCGATTGGCAAGAAGTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017466.3-1553s1c1
Sequence:CCGGCCCATTGAACTGTACAGCAATCTCGAGATTGCTGTACAGTTCAATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028166    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017466.3-1826s1c1
Sequence:CCGGGCTCGGTAGTTGTCCAAAGTTCTCGAGAACTTTGGACAACTACCGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017466.3-1418s1c1
Sequence:CCGGCCGCTGCTCTATTTGCTTCTTCTCGAGAAGAAGCAAATAGAGCAGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003965
CCRL2 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) receptor-like 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008229    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003965.3-1309s1c1
Sequence:CCGGGCAAGAAGAATAAACATGGATCTCGAGATCCATGTTTATTCTTCTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003965.3-1010s1c1
Sequence:CCGGGCGCCCTACAATATTGCATTTCTCGAGAAATGCAATATTGTAGGGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003965.3-329s1c1
Sequence:CCGGGCAGAGCAATGTGACAAGTATCTCGAGATACTTGTCACATTGCTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003965.3-784s1c1
Sequence:CCGGCCAGAAATACAAGTGTGCATTCTCGAGAATGCACACTTGTATTTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003965.3-1157s1c1
Sequence:CCGGGCGTTTCTTGATGGGACATTTCTCGAGAAATGTCCCATCAAGAAACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003965
CCRL2 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) receptor-like 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008229    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003965.3-1309s1c1
Sequence:CCGGGCAAGAAGAATAAACATGGATCTCGAGATCCATGTTTATTCTTCTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003965.3-1010s1c1
Sequence:CCGGGCGCCCTACAATATTGCATTTCTCGAGAAATGCAATATTGTAGGGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003965.3-329s1c1
Sequence:CCGGGCAGAGCAATGTGACAAGTATCTCGAGATACTTGTCACATTGCTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003965.3-784s1c1
Sequence:CCGGCCAGAAATACAAGTGTGCATTCTCGAGAATGCACACTTGTATTTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003965.3-1157s1c1
Sequence:CCGGGCGTTTCTTGATGGGACATTTCTCGAGAAATGTCCCATCAAGAAACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003965
CCRL2 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) receptor-like 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008229    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003965.3-1309s1c1
Sequence:CCGGGCAAGAAGAATAAACATGGATCTCGAGATCCATGTTTATTCTTCTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003965.3-1010s1c1
Sequence:CCGGGCGCCCTACAATATTGCATTTCTCGAGAAATGCAATATTGTAGGGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003965.3-329s1c1
Sequence:CCGGGCAGAGCAATGTGACAAGTATCTCGAGATACTTGTCACATTGCTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003965.3-784s1c1
Sequence:CCGGCCAGAAATACAAGTGTGCATTCTCGAGAATGCACACTTGTATTTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003965.3-1157s1c1
Sequence:CCGGGCGTTTCTTGATGGGACATTTCTCGAGAAATGTCCCATCAAGAAACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)