EMAIL THIS PAGE TO A FRIEND

CCRN4L

CCR4 carbon catabolite repression 4-like (S. cerevisiae)

55 Gene Product Result for
Synonyms: CCR4L NOC
UniProtKB ID: Q9UK39, D3DNY5, Q14D51, Q9HD93, Q9HD94, Q9HD95
Gene ID:
Human(25819) Summary: The protein encoded by this gene is highly similar to Nocturnin, a gene identified as a circadian clock regulated gene in Xenopus laevis. This protein and Nocturnin protein share similarity with the C-terminal domain of a yeast transcription factor, carbon catabolite repression 4 (CCR4). The mRNA abundance of a similar gene in mouse has been shown to exhibit circadian rhythmicity, which suggests a role for this protein in clock function or as a circadian clock effector. [provided by RefSeq, Jul 2008]
Mouse(12457) CCR4 carbon catabolite repression 4-like (S. cerevisiae)
Rat(310395) CCR4 carbon catabolite repression 4-like (S. cerevisiae)
domestic guinea pig(100379615) CCR4 carbon catabolite repression 4-like (S. cerevisiae)
naked mole-rat(101710110) CCR4 carbon catabolite repression 4-like (S. cerevisiae)
sheep(101117790) CCR4 carbon catabolite repression 4-like (S. cerevisiae)
Domestic Rabbit(100348337) CCR4 carbon catabolite repression 4-like (S. cerevisiae)
chicken(404779) CCR4 carbon catabolite repression 4-like (S. cerevisiae)
cow(540641) CCR4 carbon catabolite repression 4-like (S. cerevisiae)
Horse(100071468) CCR4 carbon catabolite repression 4-like (S. cerevisiae)
domestic cat(101092681) CCR4 carbon catabolite repression 4-like (S. cerevisiae)
dog(483818) CCR4 carbon catabolite repression 4-like (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012118 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012118 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012118 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009834 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009834 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009834 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012118 Rosetta Predictions human pricing
NM_138526 Rosetta Predictions rat pricing
NM_009834 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012118 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134060 predicted 885
2 SASI_Hs01_00134062 predicted 737
3 SASI_Hs01_00134063 predicted 769
4 SASI_Hs01_00134064 predicted 931
5 SASI_Hs01_00134065 predicted 1236
6 SASI_Hs01_00134066 predicted 1013
7 SASI_Hs01_00134067 predicted 595
8 SASI_Hs01_00134068 predicted 920
9 SASI_Hs01_00134069 predicted 504
10 SASI_Hs02_00343660 predicted 581
11 SASI_Hs01_00134061 predicted 618
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138526 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268146 predicted 785
2 SASI_Rn02_00268147 predicted 881
3 SASI_Rn02_00268148 predicted 1108
4 SASI_Rn02_00268149 predicted 532
5 SASI_Rn02_00268150 predicted 1524
6 SASI_Rn02_00268151 predicted 1158
7 SASI_Rn02_00268152 predicted 1341
8 SASI_Rn02_00268153 predicted 1466
9 SASI_Rn02_00268154 predicted 636
10 SASI_Rn02_00268155 predicted 1589
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009834 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108130 predicted 1211
2 SASI_Mm01_00108131 predicted 1347
3 SASI_Mm01_00108132 predicted 2066
4 SASI_Mm01_00108134 predicted 1452
5 SASI_Mm01_00108135 predicted 1945
6 SASI_Mm01_00108136 predicted 1167
7 SASI_Mm02_00317184 predicted 1471
8 SASI_Mm01_00108137 predicted 1410
9 SASI_Mm01_00108138 predicted 967
10 SASI_Mm01_00108139 predicted 1636
11 SASI_Mm01_00108133 predicted 2021
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012118
VALIDATED
CCRN4L MISSION shRNA Bacterial Glycerol Stock
CCR4 carbon catabolite repression 4-like (S. cerevisiae)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012118.x-928s1c1
Sequence:CCGGCAAGCTAGTCAACAGTGCCAACTCGAGTTGGCACTGTTGACTAGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012118.x-1811s1c1
Sequence:CCGGGATAAGACAATGCCAGAGGAACTCGAGTTCCTCTGGCATTGTCTTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012118.x-1331s1c1
Sequence:CCGGTGGTATTCTAAACATGCTCTACTCGAGTAGAGCATGTTTAGAATACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012118.x-1457s1c1
Sequence:CCGGAGCTTTACTGAGGAATCTGATCTCGAGATCAGATTCCTCAGTAAAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012118.x-1364s1c1
Sequence:CCGGGCTCTCGATCTGCTCACTGAACTCGAGTTCAGTGAGCAGATCGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_012118.2-1036s21c1
Sequence:CCGGCATCGCTGTTACCCATCTAAACTCGAGTTTAGATGGGTAACAGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_012118.2-399s21c1
Sequence:CCGGCCGGTACAAGCAGACTCTATACTCGAGTATAGAGTCTGCTTGTACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_012118.2-772s21c1
Sequence:CCGGCCAAGAGGTGGACCACTATTTCTCGAGAAATAGTGGTCCACCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231617    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_012118.2-1507s21c1
Sequence:CCGGTTTAATCACAGGAGTCTATTTCTCGAGAAATAGACTCCTGTGATTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_012118.2-497s21c1
Sequence:CCGGCTGGAGCCCATTGATCCTAAACTCGAGTTTAGGATCAATGGGCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355821    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012118.2-1764s21c1
Sequence:CCGGCTTGAATCACAAGAGTCTTAACTCGAGTTAAGACTCTTGTGATTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_012118.2-745s21c1
Sequence:CCGGGGCCTACCAGCCTGATATATTCTCGAGAATATATCAGGCTGGTAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012118.2-933s21c1
Sequence:CCGGTAGTCAACAGTGCCAATATTACTCGAGTAATATTGGCACTGTTGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012118
VALIDATED
CCRN4L MISSION shRNA shRNA Plasmid DNA
CCR4 carbon catabolite repression 4-like (S. cerevisiae)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012118.x-928s1c1
Sequence:CCGGCAAGCTAGTCAACAGTGCCAACTCGAGTTGGCACTGTTGACTAGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012118.x-1811s1c1
Sequence:CCGGGATAAGACAATGCCAGAGGAACTCGAGTTCCTCTGGCATTGTCTTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012118.x-1331s1c1
Sequence:CCGGTGGTATTCTAAACATGCTCTACTCGAGTAGAGCATGTTTAGAATACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012118.x-1457s1c1
Sequence:CCGGAGCTTTACTGAGGAATCTGATCTCGAGATCAGATTCCTCAGTAAAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012118.x-1364s1c1
Sequence:CCGGGCTCTCGATCTGCTCACTGAACTCGAGTTCAGTGAGCAGATCGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_012118.2-1036s21c1
Sequence:CCGGCATCGCTGTTACCCATCTAAACTCGAGTTTAGATGGGTAACAGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_012118.2-399s21c1
Sequence:CCGGCCGGTACAAGCAGACTCTATACTCGAGTATAGAGTCTGCTTGTACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_012118.2-772s21c1
Sequence:CCGGCCAAGAGGTGGACCACTATTTCTCGAGAAATAGTGGTCCACCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231617    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_012118.2-1507s21c1
Sequence:CCGGTTTAATCACAGGAGTCTATTTCTCGAGAAATAGACTCCTGTGATTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_012118.2-497s21c1
Sequence:CCGGCTGGAGCCCATTGATCCTAAACTCGAGTTTAGGATCAATGGGCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355821    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012118.2-1764s21c1
Sequence:CCGGCTTGAATCACAAGAGTCTTAACTCGAGTTAAGACTCTTGTGATTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_012118.2-745s21c1
Sequence:CCGGGGCCTACCAGCCTGATATATTCTCGAGAATATATCAGGCTGGTAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012118.2-933s21c1
Sequence:CCGGTAGTCAACAGTGCCAATATTACTCGAGTAATATTGGCACTGTTGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012118
VALIDATED
CCRN4L MISSION shRNA Lentiviral Transduction Particles
CCR4 carbon catabolite repression 4-like (S. cerevisiae)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012118.x-928s1c1
Sequence:CCGGCAAGCTAGTCAACAGTGCCAACTCGAGTTGGCACTGTTGACTAGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012118.x-1811s1c1
Sequence:CCGGGATAAGACAATGCCAGAGGAACTCGAGTTCCTCTGGCATTGTCTTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012118.x-1331s1c1
Sequence:CCGGTGGTATTCTAAACATGCTCTACTCGAGTAGAGCATGTTTAGAATACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012118.x-1457s1c1
Sequence:CCGGAGCTTTACTGAGGAATCTGATCTCGAGATCAGATTCCTCAGTAAAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012118.x-1364s1c1
Sequence:CCGGGCTCTCGATCTGCTCACTGAACTCGAGTTCAGTGAGCAGATCGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_012118.2-1036s21c1
Sequence:CCGGCATCGCTGTTACCCATCTAAACTCGAGTTTAGATGGGTAACAGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_012118.2-399s21c1
Sequence:CCGGCCGGTACAAGCAGACTCTATACTCGAGTATAGAGTCTGCTTGTACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_012118.2-772s21c1
Sequence:CCGGCCAAGAGGTGGACCACTATTTCTCGAGAAATAGTGGTCCACCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231617    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_012118.2-1507s21c1
Sequence:CCGGTTTAATCACAGGAGTCTATTTCTCGAGAAATAGACTCCTGTGATTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_012118.2-497s21c1
Sequence:CCGGCTGGAGCCCATTGATCCTAAACTCGAGTTTAGGATCAATGGGCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355821    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012118.2-1764s21c1
Sequence:CCGGCTTGAATCACAAGAGTCTTAACTCGAGTTAAGACTCTTGTGATTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_012118.2-745s21c1
Sequence:CCGGGGCCTACCAGCCTGATATATTCTCGAGAATATATCAGGCTGGTAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012118.2-933s21c1
Sequence:CCGGTAGTCAACAGTGCCAATATTACTCGAGTAATATTGGCACTGTTGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009834
VALIDATED
CCRN4L MISSION shRNA Bacterial Glycerol Stock
CCR4 carbon catabolite repression 4-like (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099675    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009834.1-2115s1c1
Sequence:CCGGGCACTCCAGTTTGAGCTTGTTCTCGAGAACAAGCTCAAACTGGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009834.1-1642s1c1
Sequence:CCGGGAAGAGGTCTACAAACACTTTCTCGAGAAAGTGTTTGTAGACCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009834.1-1333s1c1
Sequence:CCGGGAACACAACAACGGTCCAGATCTCGAGATCTGGACCGTTGTTGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009834.1-1636s1c1
Sequence:CCGGCCAACCGAAGAGGTCTACAAACTCGAGTTTGTAGACCTCTTCGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009834.1-1389s1c1
Sequence:CCGGGCTTATCAGCAGCACCAATATCTCGAGATATTGGTGCTGCTGATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009834
VALIDATED
CCRN4L MISSION shRNA shRNA Plasmid DNA
CCR4 carbon catabolite repression 4-like (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099675    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009834.1-2115s1c1
Sequence:CCGGGCACTCCAGTTTGAGCTTGTTCTCGAGAACAAGCTCAAACTGGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009834.1-1642s1c1
Sequence:CCGGGAAGAGGTCTACAAACACTTTCTCGAGAAAGTGTTTGTAGACCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009834.1-1333s1c1
Sequence:CCGGGAACACAACAACGGTCCAGATCTCGAGATCTGGACCGTTGTTGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009834.1-1636s1c1
Sequence:CCGGCCAACCGAAGAGGTCTACAAACTCGAGTTTGTAGACCTCTTCGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009834.1-1389s1c1
Sequence:CCGGGCTTATCAGCAGCACCAATATCTCGAGATATTGGTGCTGCTGATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009834
VALIDATED
CCRN4L MISSION shRNA Lentiviral Transduction Particles
CCR4 carbon catabolite repression 4-like (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099675    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009834.1-2115s1c1
Sequence:CCGGGCACTCCAGTTTGAGCTTGTTCTCGAGAACAAGCTCAAACTGGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009834.1-1642s1c1
Sequence:CCGGGAAGAGGTCTACAAACACTTTCTCGAGAAAGTGTTTGTAGACCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009834.1-1333s1c1
Sequence:CCGGGAACACAACAACGGTCCAGATCTCGAGATCTGGACCGTTGTTGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009834.1-1636s1c1
Sequence:CCGGCCAACCGAAGAGGTCTACAAACTCGAGTTTGTAGACCTCTTCGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009834.1-1389s1c1
Sequence:CCGGGCTTATCAGCAGCACCAATATCTCGAGATATTGGTGCTGCTGATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks