EMAIL THIS PAGE TO A FRIEND

CCS

copper chaperone for superoxide dismutase

71 Gene Product Result for
UniProtKB ID: O14618, Q2M366
Gene ID:
Human(9973) Summary: Copper chaperone for superoxide dismutase specifically delivers Cu to copper/zinc superoxide dismutase and may activate copper/zinc superoxide dismutase through direct insertion of the Cu cofactor. [provided by RefSeq, Jul 2008]
Mouse(12460) copper chaperone for superoxide dismutase
Rat(84485) copper chaperone for superoxide dismutase
naked mole-rat(101719392) copper chaperone for superoxide dismutase
domestic guinea pig(100717267) copper chaperone for superoxide dismutase
sheep(100846985) copper chaperone for superoxide dismutase
Zebrafish(550489) copper chaperone for superoxide dismutase
fruit fly(46035) CG17753 gene product from transcript CG17753-RC
Thale Cress(837808) copper chaperone for SOD1
chicken(776267) copper chaperone for superoxide dismutase
cow(515022) copper chaperone for superoxide dismutase
domestic cat(101087870) copper chaperone for superoxide dismutase
dog(442988) copper chaperone for superoxide dismutase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005125 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005125 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005125 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016892 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016892 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016892 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005125 Rosetta Predictions human pricing
NM_053425 Rosetta Predictions rat pricing
NM_016892 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005125 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106217 predicted 466
2 SASI_Hs01_00106218 predicted 627
3 SASI_Hs01_00106220 predicted 542
4 SASI_Hs01_00106221 predicted 625
5 SASI_Hs01_00106222 predicted 417
6 SASI_Hs01_00106223 predicted 457
7 SASI_Hs01_00106226 predicted 377
8 SASI_Hs02_00339037 predicted 634
9 SASI_Hs02_00339038 predicted 376
10 SASI_Hs02_00339039 predicted 377
11 SASI_Hs01_00106219 predicted 601
12 SASI_Hs01_00106224 predicted 615
13 SASI_Hs01_00106225 predicted 487
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053425 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088923 predicted 543
2 SASI_Rn01_00088925 predicted 558
3 SASI_Rn01_00088926 predicted 574
4 SASI_Rn01_00088927 predicted 775
5 SASI_Rn01_00088928 predicted 628
6 SASI_Rn01_00088929 predicted 675
7 SASI_Rn02_00265968 predicted 230
8 SASI_Rn01_00088930 predicted 621
9 SASI_Rn01_00088931 predicted 262
10 SASI_Rn01_00088932 predicted 456
11 SASI_Rn01_00088924 predicted 706
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016892 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134390 predicted 819
2 SASI_Mm01_00134392 predicted 307
3 SASI_Mm01_00134393 predicted 306
4 SASI_Mm01_00134394 predicted 393
5 SASI_Mm01_00134395 predicted 485
6 SASI_Mm01_00134396 predicted 407
7 SASI_Mm01_00134397 predicted 232
8 SASI_Mm01_00134398 predicted 616
9 SASI_Mm01_00134399 predicted 297
10 SASI_Mm02_00323724 predicted 488
11 SASI_Mm01_00134391 predicted 384
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005125
CCS MISSION shRNA Bacterial Glycerol Stock
copper chaperone for superoxide dismutase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443938    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005125.1-990s21c1
Sequence:CCGGGTGGTGTTCCCTTGGCAAATGCTCGAGCATTTGCCAAGGGAACACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005125.1-466s21c1
Sequence:CCGGCAACAGCTGTGGGAATCACTTCTCGAGAAGTGATTCCCACAGCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005125.1-714s21c1
Sequence:CCGGGGTTGGCCTGTGGCATCATTGCTCGAGCAATGATGCCACAGGCCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005125.1-955s21c1
Sequence:CCGGGTCTTTGGAGAGCTCAGTACACTCGAGTGTACTGAGCTCTCCAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005125.1-635s1c1
Sequence:CCGGCTGATTATTGATGAGGGAGAACTCGAGTTCTCCCTCATCAATAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005125.1-194s1c1
Sequence:CCGGGTCTTGGTACACACCACTCTACTCGAGTAGAGTGGTGTGTACCAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005125.1-380s1c1
Sequence:CCGGTGCCTCATCGAGGGAACTATTCTCGAGAATAGTTCCCTCGATGAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005125.1-675s1c1
Sequence:CCGGGCCATCCCTTATCCAAGATCACTCGAGTGATCTTGGATAAGGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005125.1-70s1c1
Sequence:CCGGGACCCTCTGCACGTTGGAGTTCTCGAGAACTCCAACGTGCAGAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005125
CCS MISSION shRNA shRNA Plasmid DNA
copper chaperone for superoxide dismutase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443938    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005125.1-990s21c1
Sequence:CCGGGTGGTGTTCCCTTGGCAAATGCTCGAGCATTTGCCAAGGGAACACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005125.1-466s21c1
Sequence:CCGGCAACAGCTGTGGGAATCACTTCTCGAGAAGTGATTCCCACAGCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005125.1-714s21c1
Sequence:CCGGGGTTGGCCTGTGGCATCATTGCTCGAGCAATGATGCCACAGGCCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005125.1-955s21c1
Sequence:CCGGGTCTTTGGAGAGCTCAGTACACTCGAGTGTACTGAGCTCTCCAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005125.1-635s1c1
Sequence:CCGGCTGATTATTGATGAGGGAGAACTCGAGTTCTCCCTCATCAATAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005125.1-194s1c1
Sequence:CCGGGTCTTGGTACACACCACTCTACTCGAGTAGAGTGGTGTGTACCAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005125.1-380s1c1
Sequence:CCGGTGCCTCATCGAGGGAACTATTCTCGAGAATAGTTCCCTCGATGAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005125.1-675s1c1
Sequence:CCGGGCCATCCCTTATCCAAGATCACTCGAGTGATCTTGGATAAGGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005125.1-70s1c1
Sequence:CCGGGACCCTCTGCACGTTGGAGTTCTCGAGAACTCCAACGTGCAGAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005125
CCS MISSION shRNA Lentiviral Transduction Particles
copper chaperone for superoxide dismutase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443938    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005125.1-990s21c1
Sequence:CCGGGTGGTGTTCCCTTGGCAAATGCTCGAGCATTTGCCAAGGGAACACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005125.1-466s21c1
Sequence:CCGGCAACAGCTGTGGGAATCACTTCTCGAGAAGTGATTCCCACAGCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005125.1-714s21c1
Sequence:CCGGGGTTGGCCTGTGGCATCATTGCTCGAGCAATGATGCCACAGGCCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005125.1-955s21c1
Sequence:CCGGGTCTTTGGAGAGCTCAGTACACTCGAGTGTACTGAGCTCTCCAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005125.1-635s1c1
Sequence:CCGGCTGATTATTGATGAGGGAGAACTCGAGTTCTCCCTCATCAATAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005125.1-194s1c1
Sequence:CCGGGTCTTGGTACACACCACTCTACTCGAGTAGAGTGGTGTGTACCAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005125.1-380s1c1
Sequence:CCGGTGCCTCATCGAGGGAACTATTCTCGAGAATAGTTCCCTCGATGAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005125.1-675s1c1
Sequence:CCGGGCCATCCCTTATCCAAGATCACTCGAGTGATCTTGGATAAGGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005125.1-70s1c1
Sequence:CCGGGACCCTCTGCACGTTGGAGTTCTCGAGAACTCCAACGTGCAGAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016892
VALIDATED
CCS MISSION shRNA Bacterial Glycerol Stock
copper chaperone for superoxide dismutase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000305351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016892.3-625s21c1
Sequence:CCGGACCTTCCGGATAGAGGATAAACTCGAGTTTATCCTCTATCCGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016892.3-316s21c1
Sequence:CCGGGGTATGGGCAGTAGCCAATTACTCGAGTAATTGGCTACTGCCCATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016892.3-423s21c1
Sequence:CCGGCTGCTTGATTGAGGGAACCATCTCGAGATGGTTCCCTCAATCAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016892.3-204s21c1
Sequence:CCGGCCAGAATGTGGACGTTCAGTTCTCGAGAACTGAACGTCCACATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016892.3-914s21c1
Sequence:CCGGCAGAGCCTCATGTCAGGTTATCTCGAGATAACCTGACATGAGGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101230    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016892.2-881s1c1
Sequence:CCGGCAGAGCCTCATGTCAGGTTATCTCGAGATAACCTGACATGAGGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016892.2-390s1c1
Sequence:CCGGCTGCTTGATTGAGGGAACCATCTCGAGATGGTTCCCTCAATCAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016892.2-171s1c1
Sequence:CCGGCCAGAATGTGGACGTTCAGTTCTCGAGAACTGAACGTCCACATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016892.2-236s1c1
Sequence:CCGGAGGTACAAGCACTCCTGGAAACTCGAGTTTCCAGGAGTGCTTGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016892.2-693s1c1
Sequence:CCGGCTTATCCAAGATCACAGGGAACTCGAGTTCCCTGTGATCTTGGATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016892
VALIDATED
CCS MISSION shRNA shRNA Plasmid DNA
copper chaperone for superoxide dismutase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000305351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016892.3-625s21c1
Sequence:CCGGACCTTCCGGATAGAGGATAAACTCGAGTTTATCCTCTATCCGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016892.3-316s21c1
Sequence:CCGGGGTATGGGCAGTAGCCAATTACTCGAGTAATTGGCTACTGCCCATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016892.3-423s21c1
Sequence:CCGGCTGCTTGATTGAGGGAACCATCTCGAGATGGTTCCCTCAATCAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016892.3-204s21c1
Sequence:CCGGCCAGAATGTGGACGTTCAGTTCTCGAGAACTGAACGTCCACATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016892.3-914s21c1
Sequence:CCGGCAGAGCCTCATGTCAGGTTATCTCGAGATAACCTGACATGAGGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101230    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016892.2-881s1c1
Sequence:CCGGCAGAGCCTCATGTCAGGTTATCTCGAGATAACCTGACATGAGGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016892.2-390s1c1
Sequence:CCGGCTGCTTGATTGAGGGAACCATCTCGAGATGGTTCCCTCAATCAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016892.2-171s1c1
Sequence:CCGGCCAGAATGTGGACGTTCAGTTCTCGAGAACTGAACGTCCACATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016892.2-236s1c1
Sequence:CCGGAGGTACAAGCACTCCTGGAAACTCGAGTTTCCAGGAGTGCTTGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016892.2-693s1c1
Sequence:CCGGCTTATCCAAGATCACAGGGAACTCGAGTTCCCTGTGATCTTGGATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016892
VALIDATED
CCS MISSION shRNA Lentiviral Transduction Particles
copper chaperone for superoxide dismutase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000305351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016892.3-625s21c1
Sequence:CCGGACCTTCCGGATAGAGGATAAACTCGAGTTTATCCTCTATCCGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016892.3-316s21c1
Sequence:CCGGGGTATGGGCAGTAGCCAATTACTCGAGTAATTGGCTACTGCCCATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016892.3-423s21c1
Sequence:CCGGCTGCTTGATTGAGGGAACCATCTCGAGATGGTTCCCTCAATCAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016892.3-204s21c1
Sequence:CCGGCCAGAATGTGGACGTTCAGTTCTCGAGAACTGAACGTCCACATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016892.3-914s21c1
Sequence:CCGGCAGAGCCTCATGTCAGGTTATCTCGAGATAACCTGACATGAGGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101230    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016892.2-881s1c1
Sequence:CCGGCAGAGCCTCATGTCAGGTTATCTCGAGATAACCTGACATGAGGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016892.2-390s1c1
Sequence:CCGGCTGCTTGATTGAGGGAACCATCTCGAGATGGTTCCCTCAATCAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016892.2-171s1c1
Sequence:CCGGCCAGAATGTGGACGTTCAGTTCTCGAGAACTGAACGTCCACATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016892.2-236s1c1
Sequence:CCGGAGGTACAAGCACTCCTGGAAACTCGAGTTTCCAGGAGTGCTTGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016892.2-693s1c1
Sequence:CCGGCTTATCCAAGATCACAGGGAACTCGAGTTCCCTGTGATCTTGGATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks