EMAIL THIS PAGE TO A FRIEND

CCSAP

centriole, cilia and spindle-associated protein

122 Gene Product Result for
Synonyms: C1orf96 CSAP
UniProtKB ID: Q6IQ19, A8K5X2, Q6P9G2, Q6ZW85, Q8IXU1, Q96BM2
Gene ID:
Mouse(73420) centriole, cilia and spindle associated protein
Rat(307926) centriole, cilia and spindle-associated protein
dog(479209) centriole, cilia and spindle-associated protein
cow(532798) centriole, cilia and spindle-associated protein
domestic guinea pig(100730654) centriole, cilia and spindle-associated protein
sheep(101101863) centriole, cilia and spindle-associated protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145257 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145257 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145257 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028536 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028536 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028536 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145257 Rosetta Predictions human pricing
NM_001107441 Rosetta Predictions rat pricing
NM_028536 Rosetta Predictions mouse pricing
XM_134542 Rosetta Predictions mouse pricing
XM_895097 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145257 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180497 predicted 864
2 SASI_Hs02_00365113 predicted 448
3 SASI_Hs02_00365114 predicted 1184
4 SASI_Hs01_00180499 predicted 482
5 SASI_Hs01_00180500 predicted 1089
6 SASI_Hs02_00365115 predicted 702
7 SASI_Hs01_00180501 predicted 1084
8 SASI_Hs01_00180503 predicted 863
9 SASI_Hs01_00180504 predicted 720
10 SASI_Hs01_00180505 predicted 732
11 SASI_Hs01_00180498 predicted 668
12 SASI_Hs01_00180502 predicted 908
13 SASI_Hs01_00180506 predicted 826
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107441 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228855 predicted 648
2 SASI_Rn02_00228856 predicted 569
3 SASI_Rn02_00228857 predicted 842
4 SASI_Rn02_00228858 predicted 406
5 SASI_Rn02_00228859 predicted 729
6 SASI_Rn02_00228860 predicted 812
7 SASI_Rn02_00228861 predicted 652
8 SASI_Rn02_00228862 predicted 417
9 SASI_Rn02_00228863 predicted 672
10 SASI_Rn02_00228864 predicted 676
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028536 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334007 predicted 1214
2 SASI_Mm02_00334008 predicted 1623
3 SASI_Mm02_00334009 predicted 871
4 SASI_Mm02_00334010 predicted 1356
5 SASI_Mm02_00334011 predicted 1136
6 SASI_Mm02_00334012 predicted 739
7 SASI_Mm02_00334013 predicted 1668
8 SASI_Mm02_00334014 predicted 905
9 SASI_Mm02_00334015 predicted 1402
10 SASI_Mm02_00334016 predicted 1283
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_134542 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00203314 predicted 1678
2 SASI_Mm01_00203315 predicted 2084
3 SASI_Mm01_00203316 predicted 1824
4 SASI_Mm01_00203317 predicted 1325
5 SASI_Mm01_00203318 predicted 1812
6 SASI_Mm01_00203319 predicted 1599
7 SASI_Mm01_00203320 predicted 1197
8 SASI_Mm01_00203321 predicted 2127
9 SASI_Mm01_00203322 predicted 1361
10 SASI_Mm01_00203323 predicted 1864
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895097 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00221101 predicted 924
2 SASI_Mm01_00221102 predicted 1336
3 SASI_Mm01_00221103 predicted 1076
4 SASI_Mm01_00221104 predicted 584
5 SASI_Mm01_00221105 predicted 1068
6 SASI_Mm01_00221106 predicted 852
7 SASI_Mm01_00221107 predicted 450
8 SASI_Mm01_00221108 predicted 1378
9 SASI_Mm01_00221109 predicted 611
10 SASI_Mm01_00221110 predicted 1111
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145257
CCSAP MISSION shRNA Bacterial Glycerol Stock
centriole, cilia and spindle-associated protein
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136002    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145257.2-3890s1c1
Sequence:CCGGGCAAGCAAGATGGCTGTTATTCTCGAGAATAACAGCCATCTTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145257.2-3925s1c1
Sequence:CCGGCCAGAAGATAATTCTGCACAACTCGAGTTGTGCAGAATTATCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145257.2-664s1c1
Sequence:CCGGCAAGCATCCATTTGCTCTTTACTCGAGTAAAGAGCAAATGGATGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145257.2-587s1c1
Sequence:CCGGCCAAGTGCCTTATTTGCTAGACTCGAGTCTAGCAAATAAGGCACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145257.2-901s1c1
Sequence:CCGGGACAGAATACATGAGGTGCTACTCGAGTAGCACCTCATGTATTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145257.3-1083s21c1
Sequence:CCGGCAGTTGAAGCCATAGACATTTCTCGAGAAATGTCTATGGCTTCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422078    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145257.3-1243s21c1
Sequence:CCGCAGCTTAGGTAGAGCCTATTATCTCGAGATAATAGGCTCTACCTAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145257.3-491s21c1
Sequence:CCGGGAACAAGAGAGACTGACAAATCTCGAGATTTGTCAGTCTCTCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145257
CCSAP MISSION shRNA shRNA Plasmid DNA
centriole, cilia and spindle-associated protein
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136002    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145257.2-3890s1c1
Sequence:CCGGGCAAGCAAGATGGCTGTTATTCTCGAGAATAACAGCCATCTTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145257.2-3925s1c1
Sequence:CCGGCCAGAAGATAATTCTGCACAACTCGAGTTGTGCAGAATTATCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145257.2-664s1c1
Sequence:CCGGCAAGCATCCATTTGCTCTTTACTCGAGTAAAGAGCAAATGGATGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145257.2-587s1c1
Sequence:CCGGCCAAGTGCCTTATTTGCTAGACTCGAGTCTAGCAAATAAGGCACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145257.2-901s1c1
Sequence:CCGGGACAGAATACATGAGGTGCTACTCGAGTAGCACCTCATGTATTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145257.3-1083s21c1
Sequence:CCGGCAGTTGAAGCCATAGACATTTCTCGAGAAATGTCTATGGCTTCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422078    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145257.3-1243s21c1
Sequence:CCGCAGCTTAGGTAGAGCCTATTATCTCGAGATAATAGGCTCTACCTAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145257.3-491s21c1
Sequence:CCGGGAACAAGAGAGACTGACAAATCTCGAGATTTGTCAGTCTCTCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145257
CCSAP MISSION shRNA Lentiviral Transduction Particles
centriole, cilia and spindle-associated protein
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136002    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145257.2-3890s1c1
Sequence:CCGGGCAAGCAAGATGGCTGTTATTCTCGAGAATAACAGCCATCTTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145257.2-3925s1c1
Sequence:CCGGCCAGAAGATAATTCTGCACAACTCGAGTTGTGCAGAATTATCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145257.2-664s1c1
Sequence:CCGGCAAGCATCCATTTGCTCTTTACTCGAGTAAAGAGCAAATGGATGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145257.2-587s1c1
Sequence:CCGGCCAAGTGCCTTATTTGCTAGACTCGAGTCTAGCAAATAAGGCACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145257.2-901s1c1
Sequence:CCGGGACAGAATACATGAGGTGCTACTCGAGTAGCACCTCATGTATTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145257.3-1083s21c1
Sequence:CCGGCAGTTGAAGCCATAGACATTTCTCGAGAAATGTCTATGGCTTCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422078    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145257.3-1243s21c1
Sequence:CCGCAGCTTAGGTAGAGCCTATTATCTCGAGATAATAGGCTCTACCTAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145257.3-491s21c1
Sequence:CCGGGAACAAGAGAGACTGACAAATCTCGAGATTTGTCAGTCTCTCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028536
VALIDATED
CCSAP MISSION shRNA Bacterial Glycerol Stock
centriole, cilia and spindle-associated protein
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000238647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028536.1-1130s21c1
Sequence:CCGGCCCATGGCTGACAGAGTATATCTCGAGATATACTCTGTCAGCCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028536.1-875s21c1
Sequence:CCGGGAGATCGACGAGCAAGATAAACTCGAGTTTATCTTGCTCGTCGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028536.1-904s21c1
Sequence:CCGGAGCACCCGTTTGCTCTTTATGCTCGAGCATAAAGAGCAAACGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238646    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028536.1-2417s21c1
Sequence:CCGGCTGAGCATTCCCGTGATATTTCTCGAGAAATATCACGGGAATGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028536
VALIDATED
CCSAP MISSION shRNA shRNA Plasmid DNA
centriole, cilia and spindle-associated protein
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000238647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028536.1-1130s21c1
Sequence:CCGGCCCATGGCTGACAGAGTATATCTCGAGATATACTCTGTCAGCCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028536.1-875s21c1
Sequence:CCGGGAGATCGACGAGCAAGATAAACTCGAGTTTATCTTGCTCGTCGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028536.1-904s21c1
Sequence:CCGGAGCACCCGTTTGCTCTTTATGCTCGAGCATAAAGAGCAAACGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238646    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028536.1-2417s21c1
Sequence:CCGGCTGAGCATTCCCGTGATATTTCTCGAGAAATATCACGGGAATGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028536
VALIDATED
CCSAP MISSION shRNA Lentiviral Transduction Particles
centriole, cilia and spindle-associated protein
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000238647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028536.1-1130s21c1
Sequence:CCGGCCCATGGCTGACAGAGTATATCTCGAGATATACTCTGTCAGCCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028536.1-875s21c1
Sequence:CCGGGAGATCGACGAGCAAGATAAACTCGAGTTTATCTTGCTCGTCGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028536.1-904s21c1
Sequence:CCGGAGCACCCGTTTGCTCTTTATGCTCGAGCATAAAGAGCAAACGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238646    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028536.1-2417s21c1
Sequence:CCGGCTGAGCATTCCCGTGATATTTCTCGAGAAATATCACGGGAATGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks