EMAIL THIS PAGE TO A FRIEND

CCSER1

coiled-coil serine-rich protein 1

67 Gene Product Result for
Synonyms: FAM190A
UniProtKB ID: Q9C0I3, Q4W5M0, Q86V57
Gene ID:
Mouse(232035) coiled-coil serine rich 1
Rat(500153) coiled-coil serine-rich protein 1
cow(616908) family with sequence similarity 190, member A
domestic guinea pig(100725910) coiled-coil serine-rich protein 1
naked mole-rat(101702307) coiled-coil serine-rich protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207491 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207491 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207491 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001164316 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001164316 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001164316 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207491 Rosetta Predictions human pricing
NM_001134622 Rosetta Predictions rat pricing
XM_908676 Rosetta Predictions mouse pricing
XM_988198 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207491 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00374116 predicted 525
2 SASI_Hs01_00160615 predicted 1658
3 SASI_Hs01_00160616 predicted 773
4 SASI_Hs02_00374117 predicted 853
5 SASI_Hs01_00160617 predicted 879
6 SASI_Hs01_00160618 predicted 2210
7 SASI_Hs01_00160619 predicted 2292
8 SASI_Hs02_00374118 predicted 2264
9 SASI_Hs01_00160620 predicted 2194
10 SASI_Hs01_00160621 predicted 934
11 SASI_Hs01_00160622 predicted 1160
12 SASI_Hs01_00160623 predicted 2438
13 SASI_Hs01_00160624 predicted 1911
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134622 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00257699 predicted 459
2 SASI_Rn02_00257700 predicted 411
3 SASI_Rn02_00257701 predicted 1070
4 SASI_Rn02_00257702 predicted 235
5 SASI_Rn02_00257703 predicted 1135
6 SASI_Rn02_00257704 predicted 1361
7 SASI_Rn02_00257705 predicted 463
8 SASI_Rn02_00257706 predicted 288
9 SASI_Rn02_00257707 predicted 1720
10 SASI_Rn02_00257708 predicted 670
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_908676 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00434267 predicted 2739
2 SASI_Mm02_00434268 predicted 550
3 SASI_Mm02_00434269 predicted 1828
4 SASI_Mm02_00434270 predicted 1712
5 SASI_Mm02_00434271 predicted 1088
6 SASI_Mm02_00434272 predicted 1980
7 SASI_Mm02_00434273 predicted 861
8 SASI_Mm02_00434274 predicted 503
9 SASI_Mm02_00434275 predicted 471
10 SASI_Mm02_00434276 predicted 416
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_988198 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00209895 predicted 2739
2 SASI_Mm01_00209896 predicted 547
3 SASI_Mm01_00209897 predicted 1833
4 SASI_Mm01_00209898 predicted 1709
5 SASI_Mm01_00209899 predicted 1083
6 SASI_Mm01_00209900 predicted 1980
7 SASI_Mm01_00209901 predicted 861
8 SASI_Mm01_00209902 predicted 506
9 SASI_Mm01_00209904 predicted 470
10 SASI_Mm02_00449600 predicted 420
11 SASI_Mm01_00209903 predicted 2791
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207491
CCSER1 MISSION shRNA Bacterial Glycerol Stock
coiled-coil serine-rich protein 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207491.2-523s21c1
Sequence:CCGGGGTAAACGGAGGAGCATATTCCTCGAGGAATATGCTCCTCCGTTTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207491.2-601s21c1
Sequence:CCGGACCAACCAGAACCTTAGTATTCTCGAGAATACTAAGGTTCTGGTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207491.2-388s21c1
Sequence:CCGGGTCTCCCGGTTGCCAATATTCCTCGAGGAATATTGGCAACCGGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207491.1-1697s1c1
Sequence:CCGGGTCCATTTCGTGAAGGAAGATCTCGAGATCTTCCTTCACGAAATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167627    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207491.1-3597s1c1
Sequence:CCGGGCTTTAGATATTAGGGACAATCTCGAGATTGTCCCTAATATCTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207491.1-1387s1c1
Sequence:CCGGCAGAAGGAAGTGTTATTACAACTCGAGTTGTAATAACACTTCCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167093    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207491.1-3144s1c1
Sequence:CCGGCCAAACTATATCACTCAGAATCTCGAGATTCTGAGTGATATAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207491.1-2240s1c1
Sequence:CCGGCGGCAGTCAAGACGTTATTATCTCGAGATAATAACGTCTTGACTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207491
CCSER1 MISSION shRNA shRNA Plasmid DNA
coiled-coil serine-rich protein 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207491.2-523s21c1
Sequence:CCGGGGTAAACGGAGGAGCATATTCCTCGAGGAATATGCTCCTCCGTTTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207491.2-601s21c1
Sequence:CCGGACCAACCAGAACCTTAGTATTCTCGAGAATACTAAGGTTCTGGTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207491.2-388s21c1
Sequence:CCGGGTCTCCCGGTTGCCAATATTCCTCGAGGAATATTGGCAACCGGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207491.1-1697s1c1
Sequence:CCGGGTCCATTTCGTGAAGGAAGATCTCGAGATCTTCCTTCACGAAATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167627    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207491.1-3597s1c1
Sequence:CCGGGCTTTAGATATTAGGGACAATCTCGAGATTGTCCCTAATATCTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207491.1-1387s1c1
Sequence:CCGGCAGAAGGAAGTGTTATTACAACTCGAGTTGTAATAACACTTCCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167093    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207491.1-3144s1c1
Sequence:CCGGCCAAACTATATCACTCAGAATCTCGAGATTCTGAGTGATATAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207491.1-2240s1c1
Sequence:CCGGCGGCAGTCAAGACGTTATTATCTCGAGATAATAACGTCTTGACTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207491
CCSER1 MISSION shRNA Lentiviral Transduction Particles
coiled-coil serine-rich protein 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207491.2-523s21c1
Sequence:CCGGGGTAAACGGAGGAGCATATTCCTCGAGGAATATGCTCCTCCGTTTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207491.2-601s21c1
Sequence:CCGGACCAACCAGAACCTTAGTATTCTCGAGAATACTAAGGTTCTGGTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207491.2-388s21c1
Sequence:CCGGGTCTCCCGGTTGCCAATATTCCTCGAGGAATATTGGCAACCGGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207491.1-1697s1c1
Sequence:CCGGGTCCATTTCGTGAAGGAAGATCTCGAGATCTTCCTTCACGAAATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167627    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207491.1-3597s1c1
Sequence:CCGGGCTTTAGATATTAGGGACAATCTCGAGATTGTCCCTAATATCTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207491.1-1387s1c1
Sequence:CCGGCAGAAGGAAGTGTTATTACAACTCGAGTTGTAATAACACTTCCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167093    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207491.1-3144s1c1
Sequence:CCGGCCAAACTATATCACTCAGAATCTCGAGATTCTGAGTGATATAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207491.1-2240s1c1
Sequence:CCGGCGGCAGTCAAGACGTTATTATCTCGAGATAATAACGTCTTGACTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001164316
CCSER1 MISSION shRNA Bacterial Glycerol Stock
coiled-coil serine-rich protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164316.1-1396s21c1
Sequence:CCGGAGTGATCCAGAGACCCATTTACTCGAGTAAATGGGTCTCTGGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164316.1-1519s21c1
Sequence:CCGGGCATTGGCTGAACGCTTTAAACTCGAGTTTAAAGCGTTCAGCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164316.1-2427s21c1
Sequence:CCGGGTTTGCTTCAAGAGTAGATAACTCGAGTTATCTACTCTTGAAGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164316.1-1659s21c1
Sequence:CCGGATACCGAGAAGGAAGATATATCTCGAGATATATCTTCCTTCTCGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367343    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164316.1-3235s21c1
Sequence:CCGGGCTGGCTTATGTAATCTATAACTCGAGTTATAGATTACATAAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001164316
CCSER1 MISSION shRNA shRNA Plasmid DNA
coiled-coil serine-rich protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164316.1-1396s21c1
Sequence:CCGGAGTGATCCAGAGACCCATTTACTCGAGTAAATGGGTCTCTGGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164316.1-1519s21c1
Sequence:CCGGGCATTGGCTGAACGCTTTAAACTCGAGTTTAAAGCGTTCAGCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164316.1-2427s21c1
Sequence:CCGGGTTTGCTTCAAGAGTAGATAACTCGAGTTATCTACTCTTGAAGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164316.1-1659s21c1
Sequence:CCGGATACCGAGAAGGAAGATATATCTCGAGATATATCTTCCTTCTCGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367343    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164316.1-3235s21c1
Sequence:CCGGGCTGGCTTATGTAATCTATAACTCGAGTTATAGATTACATAAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001164316
CCSER1 MISSION shRNA Lentiviral Transduction Particles
coiled-coil serine-rich protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164316.1-1396s21c1
Sequence:CCGGAGTGATCCAGAGACCCATTTACTCGAGTAAATGGGTCTCTGGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164316.1-1519s21c1
Sequence:CCGGGCATTGGCTGAACGCTTTAAACTCGAGTTTAAAGCGTTCAGCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164316.1-2427s21c1
Sequence:CCGGGTTTGCTTCAAGAGTAGATAACTCGAGTTATCTACTCTTGAAGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164316.1-1659s21c1
Sequence:CCGGATACCGAGAAGGAAGATATATCTCGAGATATATCTTCCTTCTCGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367343    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164316.1-3235s21c1
Sequence:CCGGGCTGGCTTATGTAATCTATAACTCGAGTTATAGATTACATAAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks