EMAIL THIS PAGE TO A FRIEND

CCSER2

coiled-coil serine-rich protein 2

Synonyms: FAM190B Gcap14 KIAA1128 bA486O22.1
Gene ID:
Mouse(72972) coiled-coil serine rich 2
Rat(306306) coiled-coil serine-rich protein 2
naked mole-rat(101704196) coiled-coil serine-rich protein 2
domestic guinea pig(100726729) coiled-coil serine-rich protein 2
283 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028407 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028407 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028407 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018999 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018999 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018999 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU080551 MISSION® esiRNA esiRNA human KIAA1128 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018999 Rosetta Predictions human pricing
XM_001061993 Rosetta Predictions rat pricing
XM_224672 Rosetta Predictions rat pricing
NM_027045 Rosetta Predictions mouse pricing
NM_028407 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018999 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014864 predicted 2499
2 SASI_Hs01_00014865 predicted 2074
3 SASI_Hs01_00014866 predicted 1785
4 SASI_Hs01_00014867 predicted 2127
5 SASI_Hs01_00014868 predicted 936
6 SASI_Hs01_00014869 predicted 1902
7 SASI_Hs01_00014870 predicted 2361
8 SASI_Hs01_00014871 predicted 2672
9 SASI_Hs01_00014872 predicted 2193
10 SASI_Hs01_00014873 predicted 1376
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061993 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00302015 predicted 3029
2 SASI_Rn02_00302016 predicted 2106
3 SASI_Rn02_00302017 predicted 667
4 SASI_Rn02_00302018 predicted 1219
5 SASI_Rn02_00302019 predicted 2690
6 SASI_Rn02_00302020 predicted 1936
7 SASI_Rn02_00302021 predicted 1407
8 SASI_Rn02_00302022 predicted 3337
9 SASI_Rn02_00302023 predicted 1679
10 SASI_Rn02_00302024 predicted 1701
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_224672 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382157 predicted 3031
2 SASI_Rn02_00382158 predicted 2112
3 SASI_Rn02_00382159 predicted 660
4 SASI_Rn02_00382160 predicted 1220
5 SASI_Rn02_00382161 predicted 2697
6 SASI_Rn02_00382162 predicted 1940
7 SASI_Rn02_00382163 predicted 1411
8 SASI_Rn02_00382164 predicted 3334
9 SASI_Rn02_00382165 predicted 1683
10 SASI_Rn02_00382166 predicted 1701
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027045 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198194 predicted 2134
2 SASI_Mm01_00198195 predicted 3090
3 SASI_Mm01_00198196 predicted 2194
4 SASI_Mm01_00198197 predicted 3234
5 SASI_Mm01_00198198 predicted 3072
6 SASI_Mm01_00198199 predicted 3172
7 SASI_Mm01_00198200 predicted 2982
8 SASI_Mm01_00198201 predicted 3147
9 SASI_Mm01_00198202 predicted 3205
10 SASI_Mm01_00198203 predicted 3130
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028407 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127842 predicted 308
2 SASI_Mm01_00127843 predicted 1182
3 SASI_Mm01_00127844 predicted 1217
4 SASI_Mm01_00127845 predicted 360
5 SASI_Mm01_00127846 predicted 1314
6 SASI_Mm01_00127847 predicted 1259
7 SASI_Mm01_00127848 predicted 1316
8 SASI_Mm01_00127849 predicted 1183
9 SASI_Mm01_00127850 predicted 1075
10 SASI_Mm01_00127851 predicted 1310
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028407
VALIDATED
CCSER2 MISSION shRNA Bacterial Glycerol Stock
coiled-coil serine-rich protein 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028407.2-367s1c1
Sequence:CCGGGCTCAGAAGATGTTTGTAGATCTCGAGATCTACAAACATCTTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028407.2-1185s1c1
Sequence:CCGGGCCATCCAACTTGAGTTCTTTCTCGAGAAAGAACTCAAGTTGGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028407.2-1265s1c1
Sequence:CCGGCAGGAATCACACCATGCCATTCTCGAGAATGGCATGGTGTGATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028407.2-495s1c1
Sequence:CCGGGCATGACGGAAGTGGATCATTCTCGAGAATGATCCACTTCCGTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028407.3-1502s21c1
Sequence:CCGGGTGTGGCCTCTAATCGATATTCTCGAGAATATCGATTAGAGGCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028407.3-1185s21c1
Sequence:CCGGGCCATCCAACTTGAGTTCTTTCTCGAGAAAGAACTCAAGTTGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028407.3-495s21c1
Sequence:CCGGGCATGACGGAAGTGGATCATTCTCGAGAATGATCCACTTCCGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028407.3-367s21c1
Sequence:CCGGGCTCAGAAGATGTTTGTAGATCTCGAGATCTACAAACATCTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028407
VALIDATED
CCSER2 MISSION shRNA shRNA Plasmid DNA
coiled-coil serine-rich protein 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028407.2-367s1c1
Sequence:CCGGGCTCAGAAGATGTTTGTAGATCTCGAGATCTACAAACATCTTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028407.2-1185s1c1
Sequence:CCGGGCCATCCAACTTGAGTTCTTTCTCGAGAAAGAACTCAAGTTGGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028407.2-1265s1c1
Sequence:CCGGCAGGAATCACACCATGCCATTCTCGAGAATGGCATGGTGTGATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028407.2-495s1c1
Sequence:CCGGGCATGACGGAAGTGGATCATTCTCGAGAATGATCCACTTCCGTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028407.3-1502s21c1
Sequence:CCGGGTGTGGCCTCTAATCGATATTCTCGAGAATATCGATTAGAGGCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028407.3-1185s21c1
Sequence:CCGGGCCATCCAACTTGAGTTCTTTCTCGAGAAAGAACTCAAGTTGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028407.3-495s21c1
Sequence:CCGGGCATGACGGAAGTGGATCATTCTCGAGAATGATCCACTTCCGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028407.3-367s21c1
Sequence:CCGGGCTCAGAAGATGTTTGTAGATCTCGAGATCTACAAACATCTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028407
VALIDATED
CCSER2 MISSION shRNA Lentiviral Transduction Particles
coiled-coil serine-rich protein 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028407.2-367s1c1
Sequence:CCGGGCTCAGAAGATGTTTGTAGATCTCGAGATCTACAAACATCTTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028407.2-1185s1c1
Sequence:CCGGGCCATCCAACTTGAGTTCTTTCTCGAGAAAGAACTCAAGTTGGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028407.2-1265s1c1
Sequence:CCGGCAGGAATCACACCATGCCATTCTCGAGAATGGCATGGTGTGATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028407.2-495s1c1
Sequence:CCGGGCATGACGGAAGTGGATCATTCTCGAGAATGATCCACTTCCGTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028407.3-1502s21c1
Sequence:CCGGGTGTGGCCTCTAATCGATATTCTCGAGAATATCGATTAGAGGCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028407.3-1185s21c1
Sequence:CCGGGCCATCCAACTTGAGTTCTTTCTCGAGAAAGAACTCAAGTTGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028407.3-495s21c1
Sequence:CCGGGCATGACGGAAGTGGATCATTCTCGAGAATGATCCACTTCCGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028407.3-367s21c1
Sequence:CCGGGCTCAGAAGATGTTTGTAGATCTCGAGATCTACAAACATCTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018999
VALIDATED
CCSER2 MISSION shRNA Bacterial Glycerol Stock
coiled-coil serine-rich protein 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018999.1-1833s1c1
Sequence:CCGGGCATGATATTCAACTGTCATTCTCGAGAATGACAGTTGAATATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018999.1-666s1c1
Sequence:CCGGCCCAGGTGTAACTTCTACTTTCTCGAGAAAGTAGAAGTTACACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018999.1-826s1c1
Sequence:CCGGGCTGCTAATAAGGACCAAGAACTCGAGTTCTTGGTCCTTATTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018999.1-1684s1c1
Sequence:CCGGGCTCAGAAGATGTTTGTTGATCTCGAGATCAACAAACATCTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018999.1-1039s1c1
Sequence:CCGGCCAGAGGAAATGTCTCTCAAACTCGAGTTTGAGAGACATTTCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018999.2-926s21c1
Sequence:CCGGTAATAGAGCTGTGGATCTTACCTCGAGGTAAGATCCACAGCTCTATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426136    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018999.2-2878s21c1
Sequence:CCGGGCTCAAGAGCCTTATCATTTGCTCGAGCAAATGATAAGGCTCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018999.2-958s21c1
Sequence:CCGGAGAACCAACAGCTATCCATTACTCGAGTAATGGATAGCTGTTGGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018999.2-676s21c1
Sequence:CCGGCTTCATATTCTTCGATCAATACTCGAGTATTGATCGAAGAATATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018999
VALIDATED
CCSER2 MISSION shRNA shRNA Plasmid DNA
coiled-coil serine-rich protein 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018999.1-1833s1c1
Sequence:CCGGGCATGATATTCAACTGTCATTCTCGAGAATGACAGTTGAATATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018999.1-666s1c1
Sequence:CCGGCCCAGGTGTAACTTCTACTTTCTCGAGAAAGTAGAAGTTACACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018999.1-826s1c1
Sequence:CCGGGCTGCTAATAAGGACCAAGAACTCGAGTTCTTGGTCCTTATTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018999.1-1684s1c1
Sequence:CCGGGCTCAGAAGATGTTTGTTGATCTCGAGATCAACAAACATCTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018999.1-1039s1c1
Sequence:CCGGCCAGAGGAAATGTCTCTCAAACTCGAGTTTGAGAGACATTTCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018999.2-926s21c1
Sequence:CCGGTAATAGAGCTGTGGATCTTACCTCGAGGTAAGATCCACAGCTCTATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426136    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018999.2-2878s21c1
Sequence:CCGGGCTCAAGAGCCTTATCATTTGCTCGAGCAAATGATAAGGCTCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018999.2-958s21c1
Sequence:CCGGAGAACCAACAGCTATCCATTACTCGAGTAATGGATAGCTGTTGGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018999.2-676s21c1
Sequence:CCGGCTTCATATTCTTCGATCAATACTCGAGTATTGATCGAAGAATATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018999
VALIDATED
CCSER2 MISSION shRNA Lentiviral Transduction Particles
coiled-coil serine-rich protein 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018999.1-1833s1c1
Sequence:CCGGGCATGATATTCAACTGTCATTCTCGAGAATGACAGTTGAATATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018999.1-666s1c1
Sequence:CCGGCCCAGGTGTAACTTCTACTTTCTCGAGAAAGTAGAAGTTACACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018999.1-826s1c1
Sequence:CCGGGCTGCTAATAAGGACCAAGAACTCGAGTTCTTGGTCCTTATTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018999.1-1684s1c1
Sequence:CCGGGCTCAGAAGATGTTTGTTGATCTCGAGATCAACAAACATCTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018999.1-1039s1c1
Sequence:CCGGCCAGAGGAAATGTCTCTCAAACTCGAGTTTGAGAGACATTTCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018999.2-926s21c1
Sequence:CCGGTAATAGAGCTGTGGATCTTACCTCGAGGTAAGATCCACAGCTCTATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426136    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018999.2-2878s21c1
Sequence:CCGGGCTCAAGAGCCTTATCATTTGCTCGAGCAAATGATAAGGCTCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018999.2-958s21c1
Sequence:CCGGAGAACCAACAGCTATCCATTACTCGAGTAATGGATAGCTGTTGGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018999.2-676s21c1
Sequence:CCGGCTTCATATTCTTCGATCAATACTCGAGTATTGATCGAAGAATATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks