EMAIL THIS PAGE TO A FRIEND

CCT2

chaperonin containing TCP1, subunit 2 (beta)

74 Gene Product Result for
Synonyms: 99D8.1 CCT-beta CCTB PRO1633 TCP-1-beta
Gene ID:
Human(10576) Summary: The protein encoded by this gene is a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
Mouse(12461) chaperonin containing Tcp1, subunit 2 (beta)
Rat(299809) chaperonin containing TCP1, subunit 2 (beta)
Zebrafish(192326) chaperonin containing TCP1, subunit 2 (beta)
cow(505313) chaperonin containing TCP1, subunit 2 (beta)
Horse(100059914) chaperonin containing TCP1, subunit 2 (beta)
domestic cat(101099385) chaperonin containing TCP1, subunit 2 (beta)
dog(474445) chaperonin containing TCP1, subunit 2 (beta)
fruit fly(38180) CTP:phosphocholine cytidylyltransferase 2
Thale Cress(827179) phosphorylcholine cytidylyltransferase2
chicken(417846) chaperonin containing TCP1, subunit 2 (beta)
domestic guinea pig(100721916) chaperonin containing TCP1, subunit 2 (beta)
naked mole-rat(101726118) chaperonin containing TCP1, subunit 2 (beta)
sheep(101102222) chaperonin containing TCP1, subunit 2 (beta)
Domestic Rabbit(100216334) chaperonin containing TCP1, subunit 2 (beta)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007636 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007636 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007636 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006431 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006431 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006431 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006431 siRNAs that have been validated in the lab human pricing
NM_001005905 Rosetta Predictions rat pricing
NM_007636 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006431 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226232 validated 708
1 SASI_Hs01_00226234 validated 272
2 SASI_Hs02_00341554 predicted 316
3 SASI_Hs01_00226235 predicted 1268
4 SASI_Hs01_00226236 predicted 1440
5 SASI_Hs01_00226237 predicted 1120
6 SASI_Hs01_00226238 predicted 1327
7 SASI_Hs01_00226239 predicted 1022
8 SASI_Hs02_00341555 predicted 920
9 SASI_Hs01_00226240 predicted 651
10 SASI_Hs01_00226233 predicted 967
11 SASI_Hs01_00226241 predicted 1510
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005905 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198490 predicted 488
2 SASI_Rn01_00069764 predicted 931
3 SASI_Rn01_00069765 predicted 287
4 SASI_Rn01_00069766 predicted 1540
5 SASI_Rn01_00069767 predicted 768
6 SASI_Rn01_00069768 predicted 499
7 SASI_Rn01_00069769 predicted 979
8 SASI_Rn01_00069770 predicted 883
9 SASI_Rn02_00198491 predicted 617
10 SASI_Rn01_00069771 predicted 1372
11 SASI_Rn01_00069763 predicted 895
12 SASI_Rn01_00069772 predicted 1459
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007636 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104259 predicted 1114
2 SASI_Mm01_00104260 predicted 872
3 SASI_Mm01_00104261 predicted 277
4 SASI_Mm01_00104263 predicted 1248
5 SASI_Mm01_00104264 predicted 342
6 SASI_Mm01_00104265 predicted 1564
7 SASI_Mm01_00104266 predicted 1510
8 SASI_Mm01_00104267 predicted 440
9 SASI_Mm02_00312113 predicted 604
10 SASI_Mm01_00104268 predicted 1545
11 SASI_Mm01_00104262 predicted 944
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007636
CCT2 MISSION shRNA Bacterial Glycerol Stock
chaperonin containing TCP1, subunit 2 (beta)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000345556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007636.2-308s21c1
Sequence:CCGGGCTACCATTCTCAAGAACATTCTCGAGAATGTTCTTGAGAATGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007636.2-864s21c1
Sequence:CCGGGCTCTCGGGTAAGAGTTGATTCTCGAGAATCAACTCTTACCCGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007636.2-1508s21c1
Sequence:CCGGGCTCACAGTGAAGGCCATATACTCGAGTATATGGCCTTCACTGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007636.2-1403s21c1
Sequence:CCGGGCTGTAGCAATGGAGTCGTTTCTCGAGAAACGACTCCATTGCTACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120467    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007636.1-1666s1c1
Sequence:CCGGGCATTCCCATTTGCTGATGAACTCGAGTTCATCAGCAAATGGGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007636.1-1354s1c1
Sequence:CCGGGCTGTAGCAATGGAGTCGTTTCTCGAGAAACGACTCCATTGCTACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007636.1-1459s1c1
Sequence:CCGGGCTCACAGTGAAGGCCATATACTCGAGTATATGGCCTTCACTGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007636.1-815s1c1
Sequence:CCGGGCTCTCGGGTAAGAGTTGATTCTCGAGAATCAACTCTTACCCGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007636.1-259s1c1
Sequence:CCGGGCTACCATTCTCAAGAACATTCTCGAGAATGTTCTTGAGAATGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007636
CCT2 MISSION shRNA shRNA Plasmid DNA
chaperonin containing TCP1, subunit 2 (beta)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000345556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007636.2-308s21c1
Sequence:CCGGGCTACCATTCTCAAGAACATTCTCGAGAATGTTCTTGAGAATGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007636.2-864s21c1
Sequence:CCGGGCTCTCGGGTAAGAGTTGATTCTCGAGAATCAACTCTTACCCGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007636.2-1508s21c1
Sequence:CCGGGCTCACAGTGAAGGCCATATACTCGAGTATATGGCCTTCACTGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007636.2-1403s21c1
Sequence:CCGGGCTGTAGCAATGGAGTCGTTTCTCGAGAAACGACTCCATTGCTACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120467    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007636.1-1666s1c1
Sequence:CCGGGCATTCCCATTTGCTGATGAACTCGAGTTCATCAGCAAATGGGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007636.1-1354s1c1
Sequence:CCGGGCTGTAGCAATGGAGTCGTTTCTCGAGAAACGACTCCATTGCTACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007636.1-1459s1c1
Sequence:CCGGGCTCACAGTGAAGGCCATATACTCGAGTATATGGCCTTCACTGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007636.1-815s1c1
Sequence:CCGGGCTCTCGGGTAAGAGTTGATTCTCGAGAATCAACTCTTACCCGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007636.1-259s1c1
Sequence:CCGGGCTACCATTCTCAAGAACATTCTCGAGAATGTTCTTGAGAATGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007636
CCT2 MISSION shRNA Lentiviral Transduction Particles
chaperonin containing TCP1, subunit 2 (beta)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000345556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007636.2-308s21c1
Sequence:CCGGGCTACCATTCTCAAGAACATTCTCGAGAATGTTCTTGAGAATGGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007636.2-864s21c1
Sequence:CCGGGCTCTCGGGTAAGAGTTGATTCTCGAGAATCAACTCTTACCCGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007636.2-1508s21c1
Sequence:CCGGGCTCACAGTGAAGGCCATATACTCGAGTATATGGCCTTCACTGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007636.2-1403s21c1
Sequence:CCGGGCTGTAGCAATGGAGTCGTTTCTCGAGAAACGACTCCATTGCTACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120467    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007636.1-1666s1c1
Sequence:CCGGGCATTCCCATTTGCTGATGAACTCGAGTTCATCAGCAAATGGGAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007636.1-1354s1c1
Sequence:CCGGGCTGTAGCAATGGAGTCGTTTCTCGAGAAACGACTCCATTGCTACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007636.1-1459s1c1
Sequence:CCGGGCTCACAGTGAAGGCCATATACTCGAGTATATGGCCTTCACTGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007636.1-815s1c1
Sequence:CCGGGCTCTCGGGTAAGAGTTGATTCTCGAGAATCAACTCTTACCCGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007636.1-259s1c1
Sequence:CCGGGCTACCATTCTCAAGAACATTCTCGAGAATGTTCTTGAGAATGGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006431
VALIDATED
CCT2 MISSION shRNA Bacterial Glycerol Stock
chaperonin containing TCP1, subunit 2 (beta)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000275534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006431.2-456s21c1
Sequence:CCGGTTCATCCACAGACCATCATAGCTCGAGCTATGATGGTCTGTGGATGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285418    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006431.2-1789s21c1
Sequence:CCGGGTTTATCGGTGCCCATTATATCTCGAGATATAATGGGCACCGATAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006431.2-269s21c1
Sequence:CCGGGCCTCTCTTATGGTAACCAATCTCGAGATTGGTTACCATAAGAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006431.2-1564s21c1
Sequence:CCGGCCTGGGTATAACAGAAAGTTTCTCGAGAAACTTTCTGTTATACCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006431.2-1137s21c1
Sequence:CCGGTTATCGAGGAAGTCATGATTGCTCGAGCAATCATGACTTCCTCGATAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_006431.1-1527s1c1
Sequence:CCGGCCTGGGTATAACAGAAAGTTTCTCGAGAAACTTTCTGTTATACCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_006431.1-545s1c1
Sequence:CCGGCGGGCACAACATTATCCTCAACTCGAGTTGAGGATAATGTTGTGCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006431.1-1396s1c1
Sequence:CCGGCCAACCATCATAGCTGACAATCTCGAGATTGTCAGCTATGATGGTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006431.1-232s1c1
Sequence:CCGGGCCTCTCTTATGGTAACCAATCTCGAGATTGGTTACCATAAGAGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006431.1-850s1c1
Sequence:CCGGGCAGAAATAGAACATGCGGAACTCGAGTTCCGCATGTTCTATTTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006431
VALIDATED
CCT2 MISSION shRNA shRNA Plasmid DNA
chaperonin containing TCP1, subunit 2 (beta)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000275534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006431.2-456s21c1
Sequence:CCGGTTCATCCACAGACCATCATAGCTCGAGCTATGATGGTCTGTGGATGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285418    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006431.2-1789s21c1
Sequence:CCGGGTTTATCGGTGCCCATTATATCTCGAGATATAATGGGCACCGATAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006431.2-269s21c1
Sequence:CCGGGCCTCTCTTATGGTAACCAATCTCGAGATTGGTTACCATAAGAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006431.2-1564s21c1
Sequence:CCGGCCTGGGTATAACAGAAAGTTTCTCGAGAAACTTTCTGTTATACCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006431.2-1137s21c1
Sequence:CCGGTTATCGAGGAAGTCATGATTGCTCGAGCAATCATGACTTCCTCGATAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_006431.1-1527s1c1
Sequence:CCGGCCTGGGTATAACAGAAAGTTTCTCGAGAAACTTTCTGTTATACCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_006431.1-545s1c1
Sequence:CCGGCGGGCACAACATTATCCTCAACTCGAGTTGAGGATAATGTTGTGCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006431.1-1396s1c1
Sequence:CCGGCCAACCATCATAGCTGACAATCTCGAGATTGTCAGCTATGATGGTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006431.1-232s1c1
Sequence:CCGGGCCTCTCTTATGGTAACCAATCTCGAGATTGGTTACCATAAGAGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006431.1-850s1c1
Sequence:CCGGGCAGAAATAGAACATGCGGAACTCGAGTTCCGCATGTTCTATTTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006431
VALIDATED
CCT2 MISSION shRNA Lentiviral Transduction Particles
chaperonin containing TCP1, subunit 2 (beta)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000275534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006431.2-456s21c1
Sequence:CCGGTTCATCCACAGACCATCATAGCTCGAGCTATGATGGTCTGTGGATGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285418    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006431.2-1789s21c1
Sequence:CCGGGTTTATCGGTGCCCATTATATCTCGAGATATAATGGGCACCGATAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006431.2-269s21c1
Sequence:CCGGGCCTCTCTTATGGTAACCAATCTCGAGATTGGTTACCATAAGAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006431.2-1564s21c1
Sequence:CCGGCCTGGGTATAACAGAAAGTTTCTCGAGAAACTTTCTGTTATACCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006431.2-1137s21c1
Sequence:CCGGTTATCGAGGAAGTCATGATTGCTCGAGCAATCATGACTTCCTCGATAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_006431.1-1527s1c1
Sequence:CCGGCCTGGGTATAACAGAAAGTTTCTCGAGAAACTTTCTGTTATACCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_006431.1-545s1c1
Sequence:CCGGCGGGCACAACATTATCCTCAACTCGAGTTGAGGATAATGTTGTGCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006431.1-1396s1c1
Sequence:CCGGCCAACCATCATAGCTGACAATCTCGAGATTGTCAGCTATGATGGTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006431.1-232s1c1
Sequence:CCGGGCCTCTCTTATGGTAACCAATCTCGAGATTGGTTACCATAAGAGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006431.1-850s1c1
Sequence:CCGGGCAGAAATAGAACATGCGGAACTCGAGTTCCGCATGTTCTATTTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)