EMAIL THIS PAGE TO A FRIEND

CCT3

chaperonin containing TCP1, subunit 3 (gamma)

112 Gene Product Result for
Synonyms: CCT-gamma CCTG PIG48 TCP-1-gamma TRIC5
UniProtKB ID: P49368, A6NE14, Q5SZY1, Q9BR64
Gene ID:
Human(7203) Summary: The protein encoded by this gene is a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Alternate transcriptional splice variants have been characterized for this gene. In addition, a pseudogene of this gene has been found on chromosome 8. [provided by RefSeq, Aug 2010]
Mouse(12462) chaperonin containing Tcp1, subunit 3 (gamma)
Rat(295230) chaperonin containing Tcp1, subunit 3 (gamma)
domestic guinea pig(100723202) chaperonin containing TCP1, subunit 3 (gamma)
naked mole-rat(101711551) chaperonin containing TCP1, subunit 3 (gamma)
sheep(101103858) chaperonin containing TCP1, subunit 3 (gamma)
Domestic Rabbit(100008927) chaperonin containing TCP1, subunit 3 (gamma)
Zebrafish(192327) chaperonin containing TCP1, subunit 3 (gamma)
chicken(425644) chaperonin containing TCP1, subunit 3 (gamma)
dog(480123) chaperonin containing TCP1, subunit 3 (gamma)
cow(504735) chaperonin containing TCP1, subunit 3 (gamma)
Horse(100057839) chaperonin containing TCP1, subunit 3 (gamma)
domestic cat(101083059) chaperonin containing TCP1, subunit 3 (gamma)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009836 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009836 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009836 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005998 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005998 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005998 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU130371 MISSION® esiRNA esiRNA human CCT3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008800 Rosetta Predictions human pricing
NM_001008883 Rosetta Predictions human pricing
NM_005998 Rosetta Predictions human pricing
NM_199091 Rosetta Predictions rat pricing
NM_009836 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008800 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203154 predicted 672
2 SASI_Hs01_00203155 predicted 779
3 SASI_Hs01_00203156 predicted 1010
4 SASI_Hs01_00203158 predicted 1251
5 SASI_Hs02_00305582 predicted 1056
6 SASI_Hs01_00203159 predicted 637
7 SASI_Hs01_00203160 predicted 736
8 SASI_Hs01_00203161 predicted 1237
9 SASI_Hs01_00203162 predicted 1553
10 SASI_Hs01_00203163 predicted 1174
11 SASI_Hs01_00203157 predicted 1667
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008883 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241316 predicted 785
2 SASI_Hs01_00241317 predicted 893
3 SASI_Hs01_00241318 predicted 1120
4 SASI_Hs01_00241320 predicted 1358
5 SASI_Hs02_00305586 predicted 1171
6 SASI_Hs01_00241321 predicted 748
7 SASI_Hs01_00241322 predicted 847
8 SASI_Hs01_00241323 predicted 1347
9 SASI_Hs01_00241324 predicted 1667
10 SASI_Hs01_00241325 predicted 1280
11 SASI_Hs01_00241319 predicted 1777
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005998 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054752 predicted 786
2 SASI_Hs01_00054753 predicted 895
3 SASI_Hs01_00054754 predicted 1128
4 SASI_Hs01_00054756 predicted 1358
5 SASI_Hs02_00340705 predicted 1173
6 SASI_Hs01_00054757 predicted 753
7 SASI_Hs01_00054758 predicted 856
8 SASI_Hs01_00054759 predicted 1353
9 SASI_Hs01_00054760 predicted 1667
10 SASI_Hs01_00054761 predicted 1285
11 SASI_Hs01_00054755 predicted 1778
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199091 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070916 predicted 660
2 SASI_Rn01_00070917 predicted 1164
3 SASI_Rn01_00070918 predicted 1611
4 SASI_Rn01_00070919 predicted 1161
5 SASI_Rn01_00070920 predicted 206
6 SASI_Rn01_00070921 predicted 721
7 SASI_Rn01_00070923 predicted 462
8 SASI_Rn02_00270101 predicted 1328
9 SASI_Rn01_00070924 predicted 1029
10 SASI_Rn01_00070925 predicted 1556
11 SASI_Rn01_00070922 predicted 1088
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009836 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191710 predicted 736
2 SASI_Mm01_00191713 predicted 731
3 SASI_Mm02_00317185 predicted 631
4 SASI_Mm02_00317186 predicted 1139
5 SASI_Mm02_00317187 predicted 1138
6 SASI_Mm02_00317188 predicted 645
7 SASI_Mm02_00317189 predicted 1239
8 SASI_Mm01_00191714 predicted 803
9 SASI_Mm02_00317190 predicted 276
10 SASI_Mm01_00191716 predicted 773
11 SASI_Mm01_00191711 predicted 227
12 SASI_Mm01_00191712 predicted 672
13 SASI_Mm01_00191715 predicted 1061
14 SASI_Mm01_00191717 predicted 224
15 SASI_Mm01_00191718 predicted 468
16 SASI_Mm01_00191719 predicted 744
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009836
VALIDATED
CCT3 MISSION shRNA Bacterial Glycerol Stock
chaperonin containing TCP1, subunit 3 (gamma)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120447    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009836.1-1804s1c1
Sequence:CCGGAGGAACACTGTGGACATCTTTCTCGAGAAAGATGTCCACAGTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009836.1-545s1c1
Sequence:CCGGCCGTGAGATGATGTTGAGCATCTCGAGATGCTCAACATCATCTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009836.1-1471s1c1
Sequence:CCGGCCAGTACCATTCGTCTGCTTACTCGAGTAAGCAGACGAATGGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009836.1-327s1c1
Sequence:CCGGGCAGCAAAGTCCATGATTGAACTCGAGTTCAATCATGGACTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009836.1-807s1c1
Sequence:CCGGCCTCGAATTGTGCTATTGGATCTCGAGATCCAATAGCACAATTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009836.1-1568s21c1
Sequence:CCGGCATGAAAGAGCTGGGTATTTGCTCGAGCAAATACCCAGCTCTTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009836.1-214s21c1
Sequence:CCGGGGACCTGCTTGGGACCTAAATCTCGAGATTTAGGTCCCAAGCAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009836.1-1804s21c1
Sequence:CCGGAGGAACACTGTGGACATCTTTCTCGAGAAAGATGTCCACAGTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009836.1-856s21c1
Sequence:CCGGGCCAGACCGACATCGAGATTACTCGAGTAATCTCGATGTCGGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009836.1-327s21c1
Sequence:CCGGGCAGCAAAGTCCATGATTGAACTCGAGTTCAATCATGGACTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009836
VALIDATED
CCT3 MISSION shRNA shRNA Plasmid DNA
chaperonin containing TCP1, subunit 3 (gamma)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120447    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009836.1-1804s1c1
Sequence:CCGGAGGAACACTGTGGACATCTTTCTCGAGAAAGATGTCCACAGTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009836.1-545s1c1
Sequence:CCGGCCGTGAGATGATGTTGAGCATCTCGAGATGCTCAACATCATCTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009836.1-1471s1c1
Sequence:CCGGCCAGTACCATTCGTCTGCTTACTCGAGTAAGCAGACGAATGGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009836.1-327s1c1
Sequence:CCGGGCAGCAAAGTCCATGATTGAACTCGAGTTCAATCATGGACTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009836.1-807s1c1
Sequence:CCGGCCTCGAATTGTGCTATTGGATCTCGAGATCCAATAGCACAATTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009836.1-1568s21c1
Sequence:CCGGCATGAAAGAGCTGGGTATTTGCTCGAGCAAATACCCAGCTCTTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009836.1-214s21c1
Sequence:CCGGGGACCTGCTTGGGACCTAAATCTCGAGATTTAGGTCCCAAGCAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009836.1-1804s21c1
Sequence:CCGGAGGAACACTGTGGACATCTTTCTCGAGAAAGATGTCCACAGTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009836.1-856s21c1
Sequence:CCGGGCCAGACCGACATCGAGATTACTCGAGTAATCTCGATGTCGGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009836.1-327s21c1
Sequence:CCGGGCAGCAAAGTCCATGATTGAACTCGAGTTCAATCATGGACTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009836
VALIDATED
CCT3 MISSION shRNA Lentiviral Transduction Particles
chaperonin containing TCP1, subunit 3 (gamma)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120447    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009836.1-1804s1c1
Sequence:CCGGAGGAACACTGTGGACATCTTTCTCGAGAAAGATGTCCACAGTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009836.1-545s1c1
Sequence:CCGGCCGTGAGATGATGTTGAGCATCTCGAGATGCTCAACATCATCTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009836.1-1471s1c1
Sequence:CCGGCCAGTACCATTCGTCTGCTTACTCGAGTAAGCAGACGAATGGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009836.1-327s1c1
Sequence:CCGGGCAGCAAAGTCCATGATTGAACTCGAGTTCAATCATGGACTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009836.1-807s1c1
Sequence:CCGGCCTCGAATTGTGCTATTGGATCTCGAGATCCAATAGCACAATTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009836.1-1568s21c1
Sequence:CCGGCATGAAAGAGCTGGGTATTTGCTCGAGCAAATACCCAGCTCTTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009836.1-214s21c1
Sequence:CCGGGGACCTGCTTGGGACCTAAATCTCGAGATTTAGGTCCCAAGCAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009836.1-1804s21c1
Sequence:CCGGAGGAACACTGTGGACATCTTTCTCGAGAAAGATGTCCACAGTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009836.1-856s21c1
Sequence:CCGGGCCAGACCGACATCGAGATTACTCGAGTAATCTCGATGTCGGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009836.1-327s21c1
Sequence:CCGGGCAGCAAAGTCCATGATTGAACTCGAGTTCAATCATGGACTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005998
VALIDATED
CCT3 MISSION shRNA Bacterial Glycerol Stock
chaperonin containing TCP1, subunit 3 (gamma)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158114    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005998.2-1356s1c1
Sequence:CCGGCCATGACTGGTGTGGAACAATCTCGAGATTGTTCCACACCAGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005998.2-105s1c1
Sequence:CCGGGCCAGAACACAAAGCGTGAATCTCGAGATTCACGCTTTGTGTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005998.2-158s1c1
Sequence:CCGGGCTGCCAAGACTATTGCAGATCTCGAGATCTGCAATAGTCTTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005998.2-1509s1c1
Sequence:CCGGGTGTAAATGGTGAGACGGGTACTCGAGTACCCGTCTCACCATTTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005998.2-1634s1c1
Sequence:CCGGGACATCGTTTCAGGCCACAAACTCGAGTTTGTGGCCTGAAACGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005998.2-302s1c1
Sequence:CCGGGCCAAGTCCATGATCGAAATTCTCGAGAATTTCGATCATGGACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005998.2-718s1c1
Sequence:CCGGGCGTGGAGTCATGATTAACAACTCGAGTTGTTAATCATGACTCCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_005998.2-1618s1c1
Sequence:CCGGGCTACTGCGAATTGATGACATCTCGAGATGTCATCAATTCGCAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005998.3-865s21c1
Sequence:CCGGGCGTGGAGTCATGATTAACAACTCGAGTTGTTAATCATGACTCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005998.3-305s21c1
Sequence:CCGGGCTGCCAAGACTATTGCAGATCTCGAGATCTGCAATAGTCTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005998.3-449s21c1
Sequence:CCGGGCCAAGTCCATGATCGAAATTCTCGAGAATTTCGATCATGGACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005998.3-252s21c1
Sequence:CCGGGCCAGAACACAAAGCGTGAATCTCGAGATTCACGCTTTGTGTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005998
VALIDATED
CCT3 MISSION shRNA shRNA Plasmid DNA
chaperonin containing TCP1, subunit 3 (gamma)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158114    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005998.2-1356s1c1
Sequence:CCGGCCATGACTGGTGTGGAACAATCTCGAGATTGTTCCACACCAGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005998.2-105s1c1
Sequence:CCGGGCCAGAACACAAAGCGTGAATCTCGAGATTCACGCTTTGTGTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005998.2-158s1c1
Sequence:CCGGGCTGCCAAGACTATTGCAGATCTCGAGATCTGCAATAGTCTTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005998.2-1509s1c1
Sequence:CCGGGTGTAAATGGTGAGACGGGTACTCGAGTACCCGTCTCACCATTTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005998.2-1634s1c1
Sequence:CCGGGACATCGTTTCAGGCCACAAACTCGAGTTTGTGGCCTGAAACGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005998.2-302s1c1
Sequence:CCGGGCCAAGTCCATGATCGAAATTCTCGAGAATTTCGATCATGGACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005998.2-718s1c1
Sequence:CCGGGCGTGGAGTCATGATTAACAACTCGAGTTGTTAATCATGACTCCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_005998.2-1618s1c1
Sequence:CCGGGCTACTGCGAATTGATGACATCTCGAGATGTCATCAATTCGCAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005998.3-865s21c1
Sequence:CCGGGCGTGGAGTCATGATTAACAACTCGAGTTGTTAATCATGACTCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005998.3-305s21c1
Sequence:CCGGGCTGCCAAGACTATTGCAGATCTCGAGATCTGCAATAGTCTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005998.3-449s21c1
Sequence:CCGGGCCAAGTCCATGATCGAAATTCTCGAGAATTTCGATCATGGACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005998.3-252s21c1
Sequence:CCGGGCCAGAACACAAAGCGTGAATCTCGAGATTCACGCTTTGTGTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005998
VALIDATED
CCT3 MISSION shRNA Lentiviral Transduction Particles
chaperonin containing TCP1, subunit 3 (gamma)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158114    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005998.2-1356s1c1
Sequence:CCGGCCATGACTGGTGTGGAACAATCTCGAGATTGTTCCACACCAGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005998.2-105s1c1
Sequence:CCGGGCCAGAACACAAAGCGTGAATCTCGAGATTCACGCTTTGTGTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005998.2-158s1c1
Sequence:CCGGGCTGCCAAGACTATTGCAGATCTCGAGATCTGCAATAGTCTTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005998.2-1509s1c1
Sequence:CCGGGTGTAAATGGTGAGACGGGTACTCGAGTACCCGTCTCACCATTTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005998.2-1634s1c1
Sequence:CCGGGACATCGTTTCAGGCCACAAACTCGAGTTTGTGGCCTGAAACGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005998.2-302s1c1
Sequence:CCGGGCCAAGTCCATGATCGAAATTCTCGAGAATTTCGATCATGGACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005998.2-718s1c1
Sequence:CCGGGCGTGGAGTCATGATTAACAACTCGAGTTGTTAATCATGACTCCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_005998.2-1618s1c1
Sequence:CCGGGCTACTGCGAATTGATGACATCTCGAGATGTCATCAATTCGCAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005998.3-865s21c1
Sequence:CCGGGCGTGGAGTCATGATTAACAACTCGAGTTGTTAATCATGACTCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005998.3-305s21c1
Sequence:CCGGGCTGCCAAGACTATTGCAGATCTCGAGATCTGCAATAGTCTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005998.3-449s21c1
Sequence:CCGGGCCAAGTCCATGATCGAAATTCTCGAGAATTTCGATCATGGACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005998.3-252s21c1
Sequence:CCGGGCCAGAACACAAAGCGTGAATCTCGAGATTCACGCTTTGTGTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks