EMAIL THIS PAGE TO A FRIEND

CCT4

chaperonin containing TCP1, subunit 4 (delta)

58 Gene Product Result for
Synonyms: CCT-DELTA Cctd SRB
Gene ID:
Human(10575) Summary: The chaperonin containing TCP1 (MIM 186980) complex (CCT), also called the TCP1 ring complex, consists of 2 back-to-back rings, each containing 8 unique but homologous subunits, such as CCT4. CCT assists the folding of newly translated polypeptide substrates through multiple rounds of ATP-driven release and rebinding of partially folded intermediate forms. Substrates of CCT include the cytoskeletal proteins actin (see MIM 102560) and tubulin (see MIM 191130), as well as alpha-transducin (MIM 139330) (Won et al., 1998 [PubMed 9819444]
Mouse(12464) chaperonin containing Tcp1, subunit 4 (delta)
Rat(29374) chaperonin containing Tcp1, subunit 4 (delta)
Zebrafish(393555) chaperonin containing TCP1, subunit 4 (delta)
chicken(395414) chaperonin containing TCP1, subunit 4 (delta)
cow(613336) chaperonin containing TCP1, subunit 4 (delta)
Horse(100064674) chaperonin containing TCP1, subunit 4 (delta)
domestic cat(101101209) chaperonin containing TCP1, subunit 4 (delta)
dog(482271) chaperonin containing TCP1, subunit 4 (delta)
domestic guinea pig(100732004) chaperonin containing TCP1, subunit 4 (delta)
naked mole-rat(101722176) chaperonin containing TCP1, subunit 4 (delta)
sheep(101119712) chaperonin containing TCP1, subunit 4 (delta)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
C7996 Anti-CCT4 (21-35) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
AV34271 Anti-CCT4 antibody produced in rabbit affinity isolated antibody , guinea pig, mouse, bovine, zebrafish, horse, rat, human, rabbit
western blot pricing
HPA029349 Anti-CCT4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009837 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009837 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009837 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006430 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006430 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006430 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006430 Rosetta Predictions human pricing
NM_182814 Rosetta Predictions rat pricing
NM_009837 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006430 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215297 predicted 871
2 SASI_Hs01_00215298 predicted 1019
3 SASI_Hs01_00215299 predicted 980
4 SASI_Hs01_00215300 predicted 1377
5 SASI_Hs02_00341553 predicted 1109
6 SASI_Hs01_00215302 predicted 1178
7 SASI_Hs01_00215303 predicted 1051
8 SASI_Hs01_00215304 predicted 1356
9 SASI_Hs01_00215305 predicted 660
10 SASI_Hs01_00215306 predicted 488
11 SASI_Hs01_00215301 predicted 1092
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182814 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097271 predicted 681
2 SASI_Rn01_00097272 predicted 289
3 SASI_Rn01_00097273 predicted 651
4 SASI_Rn02_00269837 predicted 1009
5 SASI_Rn01_00097274 predicted 1309
6 SASI_Rn01_00097276 predicted 855
7 SASI_Rn02_00269838 predicted 1775
8 SASI_Rn01_00097277 predicted 1154
9 SASI_Rn01_00097278 predicted 1355
10 SASI_Rn01_00097279 predicted 1734
11 SASI_Rn01_00097275 predicted 924
12 SASI_Rn01_00097280 predicted 1032
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009837 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080824 predicted 943
2 SASI_Mm02_00317191 predicted 1032
3 SASI_Mm01_00080816 predicted 854
4 SASI_Mm01_00080817 predicted 886
5 SASI_Mm02_00317192 predicted 931
6 SASI_Mm01_00080818 predicted 265
7 SASI_Mm02_00317193 predicted 955
8 SASI_Mm02_00317194 predicted 1068
9 SASI_Mm02_00317195 predicted 1670
10 SASI_Mm02_00317196 predicted 1707
11 SASI_Mm01_00080815 predicted 666
12 SASI_Mm01_00080819 predicted 407
13 SASI_Mm01_00080820 predicted 597
14 SASI_Mm01_00080821 predicted 1468
15 SASI_Mm01_00080822 predicted 1372
16 SASI_Mm01_00080823 predicted 862
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009837
VALIDATED
CCT4 MISSION shRNA Bacterial Glycerol Stock
chaperonin containing TCP1, subunit 4 (delta)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000345770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009837.1-658s21c1
Sequence:CCGGGCGCAACTACTTCATTGAATTCTCGAGAATTCAATGAAGTAGTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009837.1-1524s21c1
Sequence:CCGGGCGGATGCTATGGAAGTCATTCTCGAGAATGACTTCCATAGCATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345772    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009837.1-1805s21c1
Sequence:CCGGGCATCATTATGGACAGAAGTACTCGAGTACTTCTGTCCATAATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009837.1-289s21c1
Sequence:CCGGCGGTTGCTGATGCTATTAGAACTCGAGTTCTAATAGCATCAGCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009837.1-1083s21c1
Sequence:CCGGGCCCTTAGTGATCTTGCATTACTCGAGTAATGCAAGATCACTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120452    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009837.1-1805s1c1
Sequence:CCGGGCATCATTATGGACAGAAGTACTCGAGTACTTCTGTCCATAATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009837.1-1083s1c1
Sequence:CCGGGCCCTTAGTGATCTTGCATTACTCGAGTAATGCAAGATCACTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009837.1-289s1c1
Sequence:CCGGCGGTTGCTGATGCTATTAGAACTCGAGTTCTAATAGCATCAGCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009837.1-1524s1c1
Sequence:CCGGGCGGATGCTATGGAAGTCATTCTCGAGAATGACTTCCATAGCATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009837.1-658s1c1
Sequence:CCGGGCGCAACTACTTCATTGAATTCTCGAGAATTCAATGAAGTAGTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009837
VALIDATED
CCT4 MISSION shRNA shRNA Plasmid DNA
chaperonin containing TCP1, subunit 4 (delta)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000345770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009837.1-658s21c1
Sequence:CCGGGCGCAACTACTTCATTGAATTCTCGAGAATTCAATGAAGTAGTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009837.1-1524s21c1
Sequence:CCGGGCGGATGCTATGGAAGTCATTCTCGAGAATGACTTCCATAGCATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345772    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009837.1-1805s21c1
Sequence:CCGGGCATCATTATGGACAGAAGTACTCGAGTACTTCTGTCCATAATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009837.1-289s21c1
Sequence:CCGGCGGTTGCTGATGCTATTAGAACTCGAGTTCTAATAGCATCAGCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009837.1-1083s21c1
Sequence:CCGGGCCCTTAGTGATCTTGCATTACTCGAGTAATGCAAGATCACTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120452    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009837.1-1805s1c1
Sequence:CCGGGCATCATTATGGACAGAAGTACTCGAGTACTTCTGTCCATAATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009837.1-1083s1c1
Sequence:CCGGGCCCTTAGTGATCTTGCATTACTCGAGTAATGCAAGATCACTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009837.1-289s1c1
Sequence:CCGGCGGTTGCTGATGCTATTAGAACTCGAGTTCTAATAGCATCAGCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009837.1-1524s1c1
Sequence:CCGGGCGGATGCTATGGAAGTCATTCTCGAGAATGACTTCCATAGCATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009837.1-658s1c1
Sequence:CCGGGCGCAACTACTTCATTGAATTCTCGAGAATTCAATGAAGTAGTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009837
VALIDATED
CCT4 MISSION shRNA Lentiviral Transduction Particles
chaperonin containing TCP1, subunit 4 (delta)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000345770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009837.1-658s21c1
Sequence:CCGGGCGCAACTACTTCATTGAATTCTCGAGAATTCAATGAAGTAGTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009837.1-1524s21c1
Sequence:CCGGGCGGATGCTATGGAAGTCATTCTCGAGAATGACTTCCATAGCATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345772    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009837.1-1805s21c1
Sequence:CCGGGCATCATTATGGACAGAAGTACTCGAGTACTTCTGTCCATAATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009837.1-289s21c1
Sequence:CCGGCGGTTGCTGATGCTATTAGAACTCGAGTTCTAATAGCATCAGCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009837.1-1083s21c1
Sequence:CCGGGCCCTTAGTGATCTTGCATTACTCGAGTAATGCAAGATCACTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120452    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009837.1-1805s1c1
Sequence:CCGGGCATCATTATGGACAGAAGTACTCGAGTACTTCTGTCCATAATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009837.1-1083s1c1
Sequence:CCGGGCCCTTAGTGATCTTGCATTACTCGAGTAATGCAAGATCACTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009837.1-289s1c1
Sequence:CCGGCGGTTGCTGATGCTATTAGAACTCGAGTTCTAATAGCATCAGCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009837.1-1524s1c1
Sequence:CCGGGCGGATGCTATGGAAGTCATTCTCGAGAATGACTTCCATAGCATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009837.1-658s1c1
Sequence:CCGGGCGCAACTACTTCATTGAATTCTCGAGAATTCAATGAAGTAGTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006430
CCT4 MISSION shRNA Bacterial Glycerol Stock
chaperonin containing TCP1, subunit 4 (delta)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000318993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006430.2-1901s21c1
Sequence:CCGGCCTGAAGTTGTATTGAAACAACTCGAGTTGTTTCAATACAACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006430.2-695s21c1
Sequence:CCGGGCTTTCTCCAATGAGTGTAAACTCGAGTTTACACTCATTGGAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006430.2-1839s21c1
Sequence:CCGGGTTCCTTGTTTGGAAGATTATCTCGAGATAATCTTCCAAACAAGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006430.2-1372s21c1
Sequence:CCGGCCCTATGTGTTATTCGTTGTTCTCGAGAACAACGAATAACACATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162752    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006430.2-2066s1c1
Sequence:CCGGCCCAATATGCTCATCACTGATCTCGAGATCAGTGATGAGCATATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160262    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006430.2-1901s1c1
Sequence:CCGGCCTGAAGTTGTATTGAAACAACTCGAGTTGTTTCAATACAACTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006430.2-695s1c1
Sequence:CCGGGCTTTCTCCAATGAGTGTAAACTCGAGTTTACACTCATTGGAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006430.2-1373s1c1
Sequence:CCGGCCTATGTGTTATTCGTTGTTTCTCGAGAAACAACGAATAACACATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006430.2-277s1c1
Sequence:CCGGCGGTTGCTGATGCTATTAGAACTCGAGTTCTAATAGCATCAGCAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158846    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006430.2-1839s1c1
Sequence:CCGGGTTCCTTGTTTGGAAGATTATCTCGAGATAATCTTCCAAACAAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006430.2-1372s1c1
Sequence:CCGGCCCTATGTGTTATTCGTTGTTCTCGAGAACAACGAATAACACATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006430
CCT4 MISSION shRNA shRNA Plasmid DNA
chaperonin containing TCP1, subunit 4 (delta)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000318993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006430.2-1901s21c1
Sequence:CCGGCCTGAAGTTGTATTGAAACAACTCGAGTTGTTTCAATACAACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006430.2-695s21c1
Sequence:CCGGGCTTTCTCCAATGAGTGTAAACTCGAGTTTACACTCATTGGAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006430.2-1839s21c1
Sequence:CCGGGTTCCTTGTTTGGAAGATTATCTCGAGATAATCTTCCAAACAAGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006430.2-1372s21c1
Sequence:CCGGCCCTATGTGTTATTCGTTGTTCTCGAGAACAACGAATAACACATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162752    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006430.2-2066s1c1
Sequence:CCGGCCCAATATGCTCATCACTGATCTCGAGATCAGTGATGAGCATATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160262    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006430.2-1901s1c1
Sequence:CCGGCCTGAAGTTGTATTGAAACAACTCGAGTTGTTTCAATACAACTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006430.2-695s1c1
Sequence:CCGGGCTTTCTCCAATGAGTGTAAACTCGAGTTTACACTCATTGGAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006430.2-1373s1c1
Sequence:CCGGCCTATGTGTTATTCGTTGTTTCTCGAGAAACAACGAATAACACATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006430.2-277s1c1
Sequence:CCGGCGGTTGCTGATGCTATTAGAACTCGAGTTCTAATAGCATCAGCAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158846    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006430.2-1839s1c1
Sequence:CCGGGTTCCTTGTTTGGAAGATTATCTCGAGATAATCTTCCAAACAAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006430.2-1372s1c1
Sequence:CCGGCCCTATGTGTTATTCGTTGTTCTCGAGAACAACGAATAACACATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006430
CCT4 MISSION shRNA Lentiviral Transduction Particles
chaperonin containing TCP1, subunit 4 (delta)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000318993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006430.2-1901s21c1
Sequence:CCGGCCTGAAGTTGTATTGAAACAACTCGAGTTGTTTCAATACAACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006430.2-695s21c1
Sequence:CCGGGCTTTCTCCAATGAGTGTAAACTCGAGTTTACACTCATTGGAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006430.2-1839s21c1
Sequence:CCGGGTTCCTTGTTTGGAAGATTATCTCGAGATAATCTTCCAAACAAGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006430.2-1372s21c1
Sequence:CCGGCCCTATGTGTTATTCGTTGTTCTCGAGAACAACGAATAACACATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162752    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006430.2-2066s1c1
Sequence:CCGGCCCAATATGCTCATCACTGATCTCGAGATCAGTGATGAGCATATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160262    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006430.2-1901s1c1
Sequence:CCGGCCTGAAGTTGTATTGAAACAACTCGAGTTGTTTCAATACAACTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006430.2-695s1c1
Sequence:CCGGGCTTTCTCCAATGAGTGTAAACTCGAGTTTACACTCATTGGAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006430.2-1373s1c1
Sequence:CCGGCCTATGTGTTATTCGTTGTTTCTCGAGAAACAACGAATAACACATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006430.2-277s1c1
Sequence:CCGGCGGTTGCTGATGCTATTAGAACTCGAGTTCTAATAGCATCAGCAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158846    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006430.2-1839s1c1
Sequence:CCGGGTTCCTTGTTTGGAAGATTATCTCGAGATAATCTTCCAAACAAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006430.2-1372s1c1
Sequence:CCGGCCCTATGTGTTATTCGTTGTTCTCGAGAACAACGAATAACACATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks