EMAIL THIS PAGE TO A FRIEND

CCT5

chaperonin containing TCP1, subunit 5 (epsilon)

63 Gene Product Result for
Synonyms: CCT-epsilon CCTE TCP-1-epsilon
UniProtKB ID: P48643, A8JZY8
Gene ID:
Human(22948) Summary: The protein encoded by this gene is a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. In addition, three pseudogenes of this gene have been identified. [provided by RefSeq, Jun 2010]
Mouse(12465) chaperonin containing Tcp1, subunit 5 (epsilon)
Rat(294864) chaperonin containing Tcp1, subunit 5 (epsilon)
Zebrafish(322258) chaperonin containing TCP1, subunit 5 (epsilon)
cow(533784) chaperonin containing TCP1, subunit 5 (epsilon)
Horse(100070912) chaperonin containing TCP1, subunit 5 (epsilon)
domestic cat(100101123) chaperonin containing TCP1, subunit 5 (epsilon)
dog(606873) chaperonin containing TCP1, subunit 5 (epsilon)
chicken(420930) chaperonin containing TCP1, subunit 5 (epsilon)
fruit fly(36308) T-complex Chaperonin 5
sheep(101122217) chaperonin containing TCP1, subunit 5 (epsilon)
naked mole-rat(101723333) chaperonin containing TCP1, subunit 5 (epsilon)
domestic guinea pig(100733395) chaperonin containing TCP1, subunit 5 (epsilon)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100372 Anti-CCT5 (ab1) antibody produced in rabbit affinity isolated antibody zebrafish, rat, mouse, canine, human, rabbit, guinea pig, horse
western blot pricing
SAB2100373 Anti-CCT5 (ab2) antibody produced in rabbit affinity isolated antibody horse, zebrafish, rat, guinea pig, mouse, human, rabbit, bovine
western blot pricing
GW22834 Anti-CCT5 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human, rat
western blot pricing
SAB2701870 Anti-cct5 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry pricing
SAB2701871 Anti-cct5 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry pricing
HPA002238 Anti-CCT5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA005958 Anti-CCT5 antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
WH0022948M1 Monoclonal Anti-CCT5 antibody produced in mouse clone 4E5-4B1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2702326 Monoclonal Anti-TCP1 epsilon antibody produced in mouse clone GT639, affinity isolated antibody human
immunoprecipitation, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007637 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007637 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007637 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012073 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012073 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012073 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU006941 MISSION® esiRNA esiRNA targeting mouse Cct5 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012073 Rosetta Predictions human pricing
NM_001004078 Rosetta Predictions rat pricing
NM_007637 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012073 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077062 predicted 908
2 SASI_Hs01_00077063 predicted 784
3 SASI_Hs02_00343547 predicted 450
4 SASI_Hs01_00077065 predicted 365
5 SASI_Hs01_00077068 predicted 1333
6 SASI_Hs01_00077070 predicted 287
7 SASI_Hs01_00077071 predicted 977
8 SASI_Hs02_00343548 predicted 558
9 SASI_Hs02_00343549 predicted 307
10 SASI_Hs02_00343550 predicted 273
11 SASI_Hs01_00077064 predicted 1854
12 SASI_Hs01_00077066 predicted 411
13 SASI_Hs01_00077067 predicted 1731
14 SASI_Hs01_00077069 predicted 1678
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004078 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105863 predicted 1138
2 SASI_Rn01_00105865 predicted 672
3 SASI_Rn01_00105866 predicted 923
4 SASI_Rn01_00105867 predicted 241
5 SASI_Rn01_00105868 predicted 725
6 SASI_Rn02_00198105 predicted 1503
7 SASI_Rn01_00105869 predicted 746
8 SASI_Rn01_00105870 predicted 1113
9 SASI_Rn01_00105871 predicted 1234
10 SASI_Rn01_00105872 predicted 237
11 SASI_Rn01_00105864 predicted 1507
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007637 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134770 predicted 216
2 SASI_Mm01_00134771 predicted 1234
3 SASI_Mm01_00134772 predicted 1339
4 SASI_Mm01_00134774 predicted 1500
5 SASI_Mm02_00312114 predicted 767
6 SASI_Mm01_00134776 predicted 1400
7 SASI_Mm01_00134777 predicted 1112
8 SASI_Mm01_00134773 predicted 1018
9 SASI_Mm01_00134779 predicted 374
10 SASI_Mm02_00312115 predicted 1172
11 SASI_Mm01_00134775 predicted 339
12 SASI_Mm01_00134778 predicted 340
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007637
VALIDATED
CCT5 MISSION shRNA Bacterial Glycerol Stock
chaperonin containing TCP1, subunit 5 (epsilon)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007637.1-867s1c1
Sequence:CCGGGCCACCTAAACCTAAGACAAACTCGAGTTTGTCTTAGGTTTAGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007637.1-615s1c1
Sequence:CCGGGCTGGGCTCCAAAGTGATTAACTCGAGTTAATCACTTTGGAGCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007637.1-856s1c1
Sequence:CCGGTGTCCATTTGAGCCACCTAAACTCGAGTTTAGGTGGCTCAAATGGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007637.1-1212s1c1
Sequence:CCGGGCTGGTTATCGAGAAGTGTAACTCGAGTTACACTTCTCGATAACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007637.1-1611s1c1
Sequence:CCGGGCATGTCATAGAAACCTTGATCTCGAGATCAAGGTTTCTATGACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007637.2-615s21c1
Sequence:CCGGGCTGGGCTCCAAAGTGATTAACTCGAGTTAATCACTTTGGAGCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007637.2-867s21c1
Sequence:CCGGGCCACCTAAACCTAAGACAAACTCGAGTTTGTCTTAGGTTTAGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007637.2-1212s21c1
Sequence:CCGGGCTGGTTATCGAGAAGTGTAACTCGAGTTACACTTCTCGATAACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007637.2-856s21c1
Sequence:CCGGTGTCCATTTGAGCCACCTAAACTCGAGTTTAGGTGGCTCAAATGGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007637
VALIDATED
CCT5 MISSION shRNA shRNA Plasmid DNA
chaperonin containing TCP1, subunit 5 (epsilon)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007637.1-867s1c1
Sequence:CCGGGCCACCTAAACCTAAGACAAACTCGAGTTTGTCTTAGGTTTAGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007637.1-615s1c1
Sequence:CCGGGCTGGGCTCCAAAGTGATTAACTCGAGTTAATCACTTTGGAGCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007637.1-856s1c1
Sequence:CCGGTGTCCATTTGAGCCACCTAAACTCGAGTTTAGGTGGCTCAAATGGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007637.1-1212s1c1
Sequence:CCGGGCTGGTTATCGAGAAGTGTAACTCGAGTTACACTTCTCGATAACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007637.1-1611s1c1
Sequence:CCGGGCATGTCATAGAAACCTTGATCTCGAGATCAAGGTTTCTATGACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007637.2-615s21c1
Sequence:CCGGGCTGGGCTCCAAAGTGATTAACTCGAGTTAATCACTTTGGAGCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007637.2-867s21c1
Sequence:CCGGGCCACCTAAACCTAAGACAAACTCGAGTTTGTCTTAGGTTTAGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007637.2-1212s21c1
Sequence:CCGGGCTGGTTATCGAGAAGTGTAACTCGAGTTACACTTCTCGATAACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007637.2-856s21c1
Sequence:CCGGTGTCCATTTGAGCCACCTAAACTCGAGTTTAGGTGGCTCAAATGGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007637
VALIDATED
CCT5 MISSION shRNA Lentiviral Transduction Particles
chaperonin containing TCP1, subunit 5 (epsilon)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007637.1-867s1c1
Sequence:CCGGGCCACCTAAACCTAAGACAAACTCGAGTTTGTCTTAGGTTTAGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007637.1-615s1c1
Sequence:CCGGGCTGGGCTCCAAAGTGATTAACTCGAGTTAATCACTTTGGAGCCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007637.1-856s1c1
Sequence:CCGGTGTCCATTTGAGCCACCTAAACTCGAGTTTAGGTGGCTCAAATGGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007637.1-1212s1c1
Sequence:CCGGGCTGGTTATCGAGAAGTGTAACTCGAGTTACACTTCTCGATAACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007637.1-1611s1c1
Sequence:CCGGGCATGTCATAGAAACCTTGATCTCGAGATCAAGGTTTCTATGACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007637.2-615s21c1
Sequence:CCGGGCTGGGCTCCAAAGTGATTAACTCGAGTTAATCACTTTGGAGCCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007637.2-867s21c1
Sequence:CCGGGCCACCTAAACCTAAGACAAACTCGAGTTTGTCTTAGGTTTAGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007637.2-1212s21c1
Sequence:CCGGGCTGGTTATCGAGAAGTGTAACTCGAGTTACACTTCTCGATAACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007637.2-856s21c1
Sequence:CCGGTGTCCATTTGAGCCACCTAAACTCGAGTTTAGGTGGCTCAAATGGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012073
VALIDATED
CCT5 MISSION shRNA Bacterial Glycerol Stock
chaperonin containing TCP1, subunit 5 (epsilon)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029504    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_012073.2-1737s1c1
Sequence:CCGGCCACTTCTGTGATTAAGTAAACTCGAGTTTACTTAATCACAGAAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012073.2-1676s1c1
Sequence:CCGGGACATTCGTAAGCCTGGAGAACTCGAGTTCTCCAGGCTTACGAATGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012073.2-603s1c1
Sequence:CCGGGCTCCAAAGTGGTCAACAGTTCTCGAGAACTGTTGACCACTTTGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012073.2-1322s1c1
Sequence:CCGGCGCGATAATCGTGTGGTGTATCTCGAGATACACCACACGATTATCGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012073.2-187s1c1
Sequence:CCGGGTCTCATATAATGGCAGCAAACTCGAGTTTGCTGCCATTATATGAGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012073
VALIDATED
CCT5 MISSION shRNA shRNA Plasmid DNA
chaperonin containing TCP1, subunit 5 (epsilon)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029504    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_012073.2-1737s1c1
Sequence:CCGGCCACTTCTGTGATTAAGTAAACTCGAGTTTACTTAATCACAGAAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012073.2-1676s1c1
Sequence:CCGGGACATTCGTAAGCCTGGAGAACTCGAGTTCTCCAGGCTTACGAATGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012073.2-603s1c1
Sequence:CCGGGCTCCAAAGTGGTCAACAGTTCTCGAGAACTGTTGACCACTTTGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012073.2-1322s1c1
Sequence:CCGGCGCGATAATCGTGTGGTGTATCTCGAGATACACCACACGATTATCGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012073.2-187s1c1
Sequence:CCGGGTCTCATATAATGGCAGCAAACTCGAGTTTGCTGCCATTATATGAGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012073
VALIDATED
CCT5 MISSION shRNA Lentiviral Transduction Particles
chaperonin containing TCP1, subunit 5 (epsilon)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029504    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_012073.2-1737s1c1
Sequence:CCGGCCACTTCTGTGATTAAGTAAACTCGAGTTTACTTAATCACAGAAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012073.2-1676s1c1
Sequence:CCGGGACATTCGTAAGCCTGGAGAACTCGAGTTCTCCAGGCTTACGAATGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012073.2-603s1c1
Sequence:CCGGGCTCCAAAGTGGTCAACAGTTCTCGAGAACTGTTGACCACTTTGGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012073.2-1322s1c1
Sequence:CCGGCGCGATAATCGTGTGGTGTATCTCGAGATACACCACACGATTATCGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012073.2-187s1c1
Sequence:CCGGGTCTCATATAATGGCAGCAAACTCGAGTTTGCTGCCATTATATGAGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)