EMAIL THIS PAGE TO A FRIEND

CCT6A

chaperonin containing TCP1, subunit 6A (zeta 1)

61 Gene Product Result for
Synonyms: CCT-zeta CCT-zeta-1 CCT6 Cctz HTR3 MoDP-2 TCP-1-zeta TCP20 TCPZ TTCP20
UniProtKB ID: P40227, A6NCD2, Q3KP28, Q75LP4, Q96S46
Gene ID:
Human(908) Summary: The protein encoded by this gene is a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Alternate transcriptional splice variants of this gene, encoding different isoforms, have been characterized. In addition, several pseudogenes of this gene have been located. [provided by RefSeq, Jun 2010]
Mouse(12466) chaperonin containing Tcp1, subunit 6a (zeta)
Rat(288620) chaperonin containing Tcp1, subunit 6A (zeta 1)
Zebrafish(116994) chaperonin containing TCP1, subunit 6A (zeta 1)
chicken(417541) chaperonin containing TCP1, subunit 6A (zeta 1)
cow(521540) chaperonin containing TCP1, subunit 6A (zeta 1)
Horse(100060692) chaperonin containing TCP1, subunit 6A (zeta 1)
domestic cat(101081594) chaperonin containing TCP1, subunit 6A (zeta 1)
domestic guinea pig(100730439) chaperonin containing TCP1, subunit 6A (zeta 1)
naked mole-rat(101705231) chaperonin containing TCP1, subunit 6A (zeta 1)
sheep(101108445) chaperonin containing TCP1, subunit 6A (zeta 1)
Domestic Rabbit(100008688) chaperonin containing TCP1, subunit 6A (zeta 1)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009838 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009838 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009838 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001762 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001762 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001762 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009186 Rosetta Predictions human pricing
NM_001762 Rosetta Predictions human pricing
NM_001033684 Rosetta Predictions rat pricing
NM_009838 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009186 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176970 predicted 859
2 SASI_Hs01_00176971 predicted 721
3 SASI_Hs01_00176972 predicted 726
4 SASI_Hs01_00176973 predicted 1497
5 SASI_Hs02_00305611 predicted 976
6 SASI_Hs02_00305612 predicted 1290
7 SASI_Hs01_00176975 predicted 1491
8 SASI_Hs01_00176976 predicted 621
9 SASI_Hs01_00176977 predicted 721
10 SASI_Hs01_00176978 predicted 1353
11 SASI_Hs01_00176974 predicted 1103
12 SASI_Hs01_00176979 predicted 957
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001762 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037094 predicted 994
2 SASI_Hs01_00037095 predicted 849
3 SASI_Hs01_00037096 predicted 863
4 SASI_Hs01_00037097 predicted 1629
5 SASI_Hs02_00332490 predicted 1108
6 SASI_Hs02_00332491 predicted 1420
7 SASI_Hs01_00037099 predicted 1625
8 SASI_Hs01_00037100 predicted 763
9 SASI_Hs01_00037101 predicted 852
10 SASI_Hs01_00037102 predicted 1488
11 SASI_Hs01_00037098 predicted 1228
12 SASI_Hs01_00037103 predicted 1093
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033684 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054734 predicted 815
2 SASI_Rn01_00054735 predicted 601
3 SASI_Rn01_00054736 predicted 696
4 SASI_Rn01_00054737 predicted 1396
5 SASI_Rn01_00054738 predicted 467
6 SASI_Rn01_00054739 predicted 1275
7 SASI_Rn01_00054741 predicted 614
8 SASI_Rn01_00054742 predicted 865
9 SASI_Rn01_00054743 predicted 447
10 SASI_Rn02_00203697 predicted 1092
11 SASI_Rn01_00054740 predicted 1131
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009838 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122212 predicted 948
2 SASI_Mm01_00122213 predicted 1424
3 SASI_Mm01_00122214 predicted 602
4 SASI_Mm01_00122215 predicted 507
5 SASI_Mm01_00122216 predicted 1160
6 SASI_Mm01_00122217 predicted 1309
7 SASI_Mm01_00122218 predicted 1591
8 SASI_Mm01_00122219 predicted 482
9 SASI_Mm01_00122220 predicted 909
10 SASI_Mm01_00122221 predicted 1131
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009838
VALIDATED
CCT6A MISSION shRNA Bacterial Glycerol Stock
chaperonin containing TCP1, subunit 6A (zeta 1)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009838.1-1093s21c1
Sequence:CCGGGCAGGGCTTGTCTATGAGTATCTCGAGATACTCATAGACAAGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009838.1-756s21c1
Sequence:CCGGCGTGTCCTTAGAGTATGAGAACTCGAGTTCTCATACTCTAAGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009838.1-1428s21c1
Sequence:CCGGCCTTCAGGAAACATTAGTTAACTCGAGTTAACTAATGTTTCCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009838.1-1206s21c1
Sequence:CCGGGACTCAAATCAAGGATGCAATCTCGAGATTGCATCCTTGATTTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009838.1-1093s1c1
Sequence:CCGGGCAGGGCTTGTCTATGAGTATCTCGAGATACTCATAGACAAGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009838.1-756s1c1
Sequence:CCGGCGTGTCCTTAGAGTATGAGAACTCGAGTTCTCATACTCTAAGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120442    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009838.1-1657s1c1
Sequence:CCGGCCTGTGATACTACAGGATGTTCTCGAGAACATCCTGTAGTATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009838.1-1206s1c1
Sequence:CCGGGACTCAAATCAAGGATGCAATCTCGAGATTGCATCCTTGATTTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009838.1-1428s1c1
Sequence:CCGGCCTTCAGGAAACATTAGTTAACTCGAGTTAACTAATGTTTCCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009838
VALIDATED
CCT6A MISSION shRNA shRNA Plasmid DNA
chaperonin containing TCP1, subunit 6A (zeta 1)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009838.1-1093s21c1
Sequence:CCGGGCAGGGCTTGTCTATGAGTATCTCGAGATACTCATAGACAAGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009838.1-756s21c1
Sequence:CCGGCGTGTCCTTAGAGTATGAGAACTCGAGTTCTCATACTCTAAGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009838.1-1428s21c1
Sequence:CCGGCCTTCAGGAAACATTAGTTAACTCGAGTTAACTAATGTTTCCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009838.1-1206s21c1
Sequence:CCGGGACTCAAATCAAGGATGCAATCTCGAGATTGCATCCTTGATTTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009838.1-1093s1c1
Sequence:CCGGGCAGGGCTTGTCTATGAGTATCTCGAGATACTCATAGACAAGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009838.1-756s1c1
Sequence:CCGGCGTGTCCTTAGAGTATGAGAACTCGAGTTCTCATACTCTAAGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120442    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009838.1-1657s1c1
Sequence:CCGGCCTGTGATACTACAGGATGTTCTCGAGAACATCCTGTAGTATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009838.1-1206s1c1
Sequence:CCGGGACTCAAATCAAGGATGCAATCTCGAGATTGCATCCTTGATTTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009838.1-1428s1c1
Sequence:CCGGCCTTCAGGAAACATTAGTTAACTCGAGTTAACTAATGTTTCCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009838
VALIDATED
CCT6A MISSION shRNA Lentiviral Transduction Particles
chaperonin containing TCP1, subunit 6A (zeta 1)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009838.1-1093s21c1
Sequence:CCGGGCAGGGCTTGTCTATGAGTATCTCGAGATACTCATAGACAAGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009838.1-756s21c1
Sequence:CCGGCGTGTCCTTAGAGTATGAGAACTCGAGTTCTCATACTCTAAGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009838.1-1428s21c1
Sequence:CCGGCCTTCAGGAAACATTAGTTAACTCGAGTTAACTAATGTTTCCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009838.1-1206s21c1
Sequence:CCGGGACTCAAATCAAGGATGCAATCTCGAGATTGCATCCTTGATTTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009838.1-1093s1c1
Sequence:CCGGGCAGGGCTTGTCTATGAGTATCTCGAGATACTCATAGACAAGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009838.1-756s1c1
Sequence:CCGGCGTGTCCTTAGAGTATGAGAACTCGAGTTCTCATACTCTAAGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120442    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009838.1-1657s1c1
Sequence:CCGGCCTGTGATACTACAGGATGTTCTCGAGAACATCCTGTAGTATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009838.1-1206s1c1
Sequence:CCGGGACTCAAATCAAGGATGCAATCTCGAGATTGCATCCTTGATTTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009838.1-1428s1c1
Sequence:CCGGCCTTCAGGAAACATTAGTTAACTCGAGTTAACTAATGTTTCCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001762
VALIDATED
CCT6A MISSION shRNA Bacterial Glycerol Stock
chaperonin containing TCP1, subunit 6A (zeta 1)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000333801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001762.3-866s21c1
Sequence:CCGGCGTGTCATTAGAGTATGAGAACTCGAGTTCTCATACTCTAATGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291370    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001762.3-2286s21c1
Sequence:CCGGCGCCACAAAGTTGTAGGAAATCTCGAGATTTCCTACAACTTTGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001762.3-619s21c1
Sequence:CCGGCCAGAACATCTCTTCGTACTACTCGAGTAGTACGAAGAGATGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001762.3-1307s21c1
Sequence:CCGGGCACACACTCACTCAGATCAACTCGAGTTGATCTGAGTGAGTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001762.3-2286s1c1
Sequence:CCGGCGCCACAAAGTTGTAGGAAATCTCGAGATTTCCTACAACTTTGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001762.3-619s1c1
Sequence:CCGGCCAGAACATCTCTTCGTACTACTCGAGTAGTACGAAGAGATGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001762.3-1307s1c1
Sequence:CCGGGCACACACTCACTCAGATCAACTCGAGTTGATCTGAGTGAGTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001762.3-1426s1c1
Sequence:CCGGCCCTGATTAAACATAAGCCCACTCGAGTGGGCTTATGTTTAATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001762
VALIDATED
CCT6A MISSION shRNA shRNA Plasmid DNA
chaperonin containing TCP1, subunit 6A (zeta 1)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000333801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001762.3-866s21c1
Sequence:CCGGCGTGTCATTAGAGTATGAGAACTCGAGTTCTCATACTCTAATGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291370    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001762.3-2286s21c1
Sequence:CCGGCGCCACAAAGTTGTAGGAAATCTCGAGATTTCCTACAACTTTGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001762.3-619s21c1
Sequence:CCGGCCAGAACATCTCTTCGTACTACTCGAGTAGTACGAAGAGATGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001762.3-1307s21c1
Sequence:CCGGGCACACACTCACTCAGATCAACTCGAGTTGATCTGAGTGAGTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001762.3-2286s1c1
Sequence:CCGGCGCCACAAAGTTGTAGGAAATCTCGAGATTTCCTACAACTTTGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001762.3-619s1c1
Sequence:CCGGCCAGAACATCTCTTCGTACTACTCGAGTAGTACGAAGAGATGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001762.3-1307s1c1
Sequence:CCGGGCACACACTCACTCAGATCAACTCGAGTTGATCTGAGTGAGTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001762.3-1426s1c1
Sequence:CCGGCCCTGATTAAACATAAGCCCACTCGAGTGGGCTTATGTTTAATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001762
VALIDATED
CCT6A MISSION shRNA Lentiviral Transduction Particles
chaperonin containing TCP1, subunit 6A (zeta 1)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000333801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001762.3-866s21c1
Sequence:CCGGCGTGTCATTAGAGTATGAGAACTCGAGTTCTCATACTCTAATGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291370    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001762.3-2286s21c1
Sequence:CCGGCGCCACAAAGTTGTAGGAAATCTCGAGATTTCCTACAACTTTGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001762.3-619s21c1
Sequence:CCGGCCAGAACATCTCTTCGTACTACTCGAGTAGTACGAAGAGATGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001762.3-1307s21c1
Sequence:CCGGGCACACACTCACTCAGATCAACTCGAGTTGATCTGAGTGAGTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001762.3-2286s1c1
Sequence:CCGGCGCCACAAAGTTGTAGGAAATCTCGAGATTTCCTACAACTTTGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001762.3-619s1c1
Sequence:CCGGCCAGAACATCTCTTCGTACTACTCGAGTAGTACGAAGAGATGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001762.3-1307s1c1
Sequence:CCGGGCACACACTCACTCAGATCAACTCGAGTTGATCTGAGTGAGTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001762.3-1426s1c1
Sequence:CCGGCCCTGATTAAACATAAGCCCACTCGAGTGGGCTTATGTTTAATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks