EMAIL THIS PAGE TO A FRIEND

CCT6B

chaperonin containing TCP1, subunit 6B (zeta 2)

58 Gene Product Result for
Synonyms: CCT-zeta-2 CCTZ-2 Cctz2 TCP-1-zeta-2 TSA303
UniProtKB ID: Q92526, B4DX20, B4DYB0, Q8TC34
Gene ID:
Human(10693) Summary: This gene encodes a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Alternate transcriptional splice variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
Mouse(12467) chaperonin containing Tcp1, subunit 6b (zeta)
Rat(363658) chaperonin containing Tcp1, subunit 6B (zeta 2)
domestic guinea pig(100716821) chaperonin containing TCP1, subunit 6B (zeta 2)
naked mole-rat(101725671) chaperonin containing TCP1, subunit 6B (zeta 2)
sheep(101118966) chaperonin containing TCP1, subunit 6B (zeta 2)
dog(491146) chaperonin containing TCP1, subunit 6B (zeta 2)
cow(538090) chaperonin containing TCP1, subunit 6B (zeta 2)
domestic cat(101097435) chaperonin containing TCP1, subunit 6B (zeta 2)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009839 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009839 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009839 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006584 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006584 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006584 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006584 Rosetta Predictions human pricing
NM_001014228 Rosetta Predictions rat pricing
NM_009839 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006584 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227319 predicted 1454
2 SASI_Hs01_00227320 predicted 1185
3 SASI_Hs01_00227321 predicted 1349
4 SASI_Hs01_00227322 predicted 360
5 SASI_Hs02_00341878 predicted 1184
6 SASI_Hs01_00227323 predicted 1234
7 SASI_Hs02_00341879 predicted 287
8 SASI_Hs01_00227326 predicted 1111
9 SASI_Hs02_00341880 predicted 359
10 SASI_Hs01_00227328 predicted 1198
11 SASI_Hs01_00227324 predicted 777
12 SASI_Hs01_00227325 predicted 1367
13 SASI_Hs01_00227327 predicted 641
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014228 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201766 predicted 961
2 SASI_Rn01_00081630 predicted 375
3 SASI_Rn01_00081631 predicted 625
4 SASI_Rn01_00081632 predicted 985
5 SASI_Rn01_00081633 predicted 775
6 SASI_Rn01_00081634 predicted 842
7 SASI_Rn01_00081635 predicted 621
8 SASI_Rn01_00081637 predicted 1213
9 SASI_Rn01_00081638 predicted 1228
10 SASI_Rn02_00201767 predicted 1284
11 SASI_Rn01_00081636 predicted 1136
12 SASI_Rn01_00081639 predicted 533
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009839 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161062 predicted 628
2 SASI_Mm01_00161063 predicted 379
3 SASI_Mm01_00161064 predicted 1022
4 SASI_Mm01_00161065 predicted 1172
5 SASI_Mm01_00161066 predicted 240
6 SASI_Mm01_00161067 predicted 770
7 SASI_Mm01_00161068 predicted 977
8 SASI_Mm01_00161069 predicted 563
9 SASI_Mm02_00317197 predicted 756
10 SASI_Mm01_00161071 predicted 1211
11 SASI_Mm01_00161070 predicted 479
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009839
CCT6B MISSION shRNA Bacterial Glycerol Stock
chaperonin containing TCP1, subunit 6B (zeta 2)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009839.1-459s1c1
Sequence:CCGGAGACGAAAGCACTTGAAGTTTCTCGAGAAACTTCAAGTGCTTTCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009839.1-638s1c1
Sequence:CCGGGATCTCTTCATGGTGGAAATTCTCGAGAATTTCCACCATGAAGAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009839.1-1214s1c1
Sequence:CCGGCCAAATAAGCATACTCTCATACTCGAGTATGAGAGTATGCTTATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009839.1-1329s1c1
Sequence:CCGGCGATAGCAGAAGCTCTTGTTACTCGAGTAACAAGAGCTTCTGCTATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009839.1-245s1c1
Sequence:CCGGCTCACCAAAGACGGCAATGTACTCGAGTACATTGCCGTCTTTGGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009839.2-1575s21c1
Sequence:CCGGTTCACTCTTGCACGGTGATTGCTCGAGCAATCACCGTGCAAGAGTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009839.2-352s21c1
Sequence:CCGGGATCATTGGAGAGTTGCTAAACTCGAGTTTAGCAACTCTCCAATGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009839.2-547s21c1
Sequence:CCGGTGAACTGGCCGACATACTAACCTCGAGGTTAGTATGTCGGCCAGTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009839.2-1534s21c1
Sequence:CCGGAGCAGGAATCTGGGATAATTACTCGAGTAATTATCCCAGATTCCTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009839.2-399s21c1
Sequence:CCGGGCCTGCACCCTAGAATCATAACTCGAGTTATGATTCTAGGGTGCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009839
CCT6B MISSION shRNA shRNA Plasmid DNA
chaperonin containing TCP1, subunit 6B (zeta 2)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009839.1-459s1c1
Sequence:CCGGAGACGAAAGCACTTGAAGTTTCTCGAGAAACTTCAAGTGCTTTCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009839.1-638s1c1
Sequence:CCGGGATCTCTTCATGGTGGAAATTCTCGAGAATTTCCACCATGAAGAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009839.1-1214s1c1
Sequence:CCGGCCAAATAAGCATACTCTCATACTCGAGTATGAGAGTATGCTTATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009839.1-1329s1c1
Sequence:CCGGCGATAGCAGAAGCTCTTGTTACTCGAGTAACAAGAGCTTCTGCTATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009839.1-245s1c1
Sequence:CCGGCTCACCAAAGACGGCAATGTACTCGAGTACATTGCCGTCTTTGGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009839.2-1575s21c1
Sequence:CCGGTTCACTCTTGCACGGTGATTGCTCGAGCAATCACCGTGCAAGAGTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009839.2-352s21c1
Sequence:CCGGGATCATTGGAGAGTTGCTAAACTCGAGTTTAGCAACTCTCCAATGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009839.2-547s21c1
Sequence:CCGGTGAACTGGCCGACATACTAACCTCGAGGTTAGTATGTCGGCCAGTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009839.2-1534s21c1
Sequence:CCGGAGCAGGAATCTGGGATAATTACTCGAGTAATTATCCCAGATTCCTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009839.2-399s21c1
Sequence:CCGGGCCTGCACCCTAGAATCATAACTCGAGTTATGATTCTAGGGTGCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009839
CCT6B MISSION shRNA Lentiviral Transduction Particles
chaperonin containing TCP1, subunit 6B (zeta 2)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009839.1-459s1c1
Sequence:CCGGAGACGAAAGCACTTGAAGTTTCTCGAGAAACTTCAAGTGCTTTCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009839.1-638s1c1
Sequence:CCGGGATCTCTTCATGGTGGAAATTCTCGAGAATTTCCACCATGAAGAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009839.1-1214s1c1
Sequence:CCGGCCAAATAAGCATACTCTCATACTCGAGTATGAGAGTATGCTTATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009839.1-1329s1c1
Sequence:CCGGCGATAGCAGAAGCTCTTGTTACTCGAGTAACAAGAGCTTCTGCTATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009839.1-245s1c1
Sequence:CCGGCTCACCAAAGACGGCAATGTACTCGAGTACATTGCCGTCTTTGGTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009839.2-1575s21c1
Sequence:CCGGTTCACTCTTGCACGGTGATTGCTCGAGCAATCACCGTGCAAGAGTGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009839.2-352s21c1
Sequence:CCGGGATCATTGGAGAGTTGCTAAACTCGAGTTTAGCAACTCTCCAATGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009839.2-547s21c1
Sequence:CCGGTGAACTGGCCGACATACTAACCTCGAGGTTAGTATGTCGGCCAGTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009839.2-1534s21c1
Sequence:CCGGAGCAGGAATCTGGGATAATTACTCGAGTAATTATCCCAGATTCCTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009839.2-399s21c1
Sequence:CCGGGCCTGCACCCTAGAATCATAACTCGAGTTATGATTCTAGGGTGCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006584
VALIDATED
CCT6B MISSION shRNA Bacterial Glycerol Stock
chaperonin containing TCP1, subunit 6B (zeta 2)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006584.1-1515s1c1
Sequence:CCGGGCAGGAGTTTGGGATAATTATCTCGAGATAATTATCCCAAACTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006584.1-1565s1c1
Sequence:CCGGCACAGTGATTGCCACCAACATCTCGAGATGTTGGTGGCAATCACTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006584.1-227s1c1
Sequence:CCGGGCTGCTCGATGAGATGCAAATCTCGAGATTTGCATCTCATCGAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006584.1-1554s1c1
Sequence:CCGGCTTCACTCTTGCACAGTGATTCTCGAGAATCACTGTGCAAGAGTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006584.1-1150s1c1
Sequence:CCGGGCTCTGTTACCTTGTTGGTTACTCGAGTAACCAACAAGGTAACAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006584.1-383s1c1
Sequence:CCGGGCACCCTAGAATAATAGCTGACTCGAGTCAGCTATTATTCTAGGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006584.1-696s1c1
Sequence:CCGGCCAGATATGAAGAAGCGAGTACTCGAGTACTCGCTTCTTCATATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006584.1-1362s1c1
Sequence:CCGGGCTGATGCCTTACTCATTATTCTCGAGAATAATGAGTAAGGCATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006584.2-1516s21c1
Sequence:CCGGACAACTTGTGGGCGTAGATTTCTCGAGAAATCTACGCCCACAAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006584.2-1134s21c1
Sequence:CCGGCTGGTCTTGTGTATGAGTATACTCGAGTATACTCATACACAAGACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006584.2-1203s21c1
Sequence:CCGGGCTCTGTTACCTTGTTGGTTACTCGAGTAACCAACAAGGTAACAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006584.2-1568s21c1
Sequence:CCGGGCAGGAGTTTGGGATAATTATCTCGAGATAATTATCCCAAACTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006584.2-1468s21c1
Sequence:CCGGCCCACAGGAAACATTAGTAAACTCGAGTTTACTAATGTTTCCTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006584
VALIDATED
CCT6B MISSION shRNA shRNA Plasmid DNA
chaperonin containing TCP1, subunit 6B (zeta 2)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006584.1-1515s1c1
Sequence:CCGGGCAGGAGTTTGGGATAATTATCTCGAGATAATTATCCCAAACTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006584.1-1565s1c1
Sequence:CCGGCACAGTGATTGCCACCAACATCTCGAGATGTTGGTGGCAATCACTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006584.1-227s1c1
Sequence:CCGGGCTGCTCGATGAGATGCAAATCTCGAGATTTGCATCTCATCGAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006584.1-1554s1c1
Sequence:CCGGCTTCACTCTTGCACAGTGATTCTCGAGAATCACTGTGCAAGAGTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006584.1-1150s1c1
Sequence:CCGGGCTCTGTTACCTTGTTGGTTACTCGAGTAACCAACAAGGTAACAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006584.1-383s1c1
Sequence:CCGGGCACCCTAGAATAATAGCTGACTCGAGTCAGCTATTATTCTAGGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006584.1-696s1c1
Sequence:CCGGCCAGATATGAAGAAGCGAGTACTCGAGTACTCGCTTCTTCATATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006584.1-1362s1c1
Sequence:CCGGGCTGATGCCTTACTCATTATTCTCGAGAATAATGAGTAAGGCATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006584.2-1516s21c1
Sequence:CCGGACAACTTGTGGGCGTAGATTTCTCGAGAAATCTACGCCCACAAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006584.2-1134s21c1
Sequence:CCGGCTGGTCTTGTGTATGAGTATACTCGAGTATACTCATACACAAGACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006584.2-1203s21c1
Sequence:CCGGGCTCTGTTACCTTGTTGGTTACTCGAGTAACCAACAAGGTAACAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006584.2-1568s21c1
Sequence:CCGGGCAGGAGTTTGGGATAATTATCTCGAGATAATTATCCCAAACTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006584.2-1468s21c1
Sequence:CCGGCCCACAGGAAACATTAGTAAACTCGAGTTTACTAATGTTTCCTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006584
VALIDATED
CCT6B MISSION shRNA Lentiviral Transduction Particles
chaperonin containing TCP1, subunit 6B (zeta 2)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006584.1-1515s1c1
Sequence:CCGGGCAGGAGTTTGGGATAATTATCTCGAGATAATTATCCCAAACTCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006584.1-1565s1c1
Sequence:CCGGCACAGTGATTGCCACCAACATCTCGAGATGTTGGTGGCAATCACTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006584.1-227s1c1
Sequence:CCGGGCTGCTCGATGAGATGCAAATCTCGAGATTTGCATCTCATCGAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006584.1-1554s1c1
Sequence:CCGGCTTCACTCTTGCACAGTGATTCTCGAGAATCACTGTGCAAGAGTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006584.1-1150s1c1
Sequence:CCGGGCTCTGTTACCTTGTTGGTTACTCGAGTAACCAACAAGGTAACAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006584.1-383s1c1
Sequence:CCGGGCACCCTAGAATAATAGCTGACTCGAGTCAGCTATTATTCTAGGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006584.1-696s1c1
Sequence:CCGGCCAGATATGAAGAAGCGAGTACTCGAGTACTCGCTTCTTCATATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006584.1-1362s1c1
Sequence:CCGGGCTGATGCCTTACTCATTATTCTCGAGAATAATGAGTAAGGCATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006584.2-1516s21c1
Sequence:CCGGACAACTTGTGGGCGTAGATTTCTCGAGAAATCTACGCCCACAAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006584.2-1134s21c1
Sequence:CCGGCTGGTCTTGTGTATGAGTATACTCGAGTATACTCATACACAAGACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006584.2-1203s21c1
Sequence:CCGGGCTCTGTTACCTTGTTGGTTACTCGAGTAACCAACAAGGTAACAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006584.2-1568s21c1
Sequence:CCGGGCAGGAGTTTGGGATAATTATCTCGAGATAATTATCCCAAACTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006584.2-1468s21c1
Sequence:CCGGCCCACAGGAAACATTAGTAAACTCGAGTTTACTAATGTTTCCTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)