EMAIL THIS PAGE TO A FRIEND

CCT7

chaperonin containing TCP1, subunit 7 (eta)

67 Gene Product Result for
Synonyms: CCTETA CCTH NIP7-1 TCP1ETA
Gene ID:
Human(10574) Summary: This gene encodes a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 5 and 6. [provided by RefSeq, Oct 2009]
Mouse(12468) chaperonin containing Tcp1, subunit 7 (eta)
Rat(297406) chaperonin containing Tcp1, subunit 7 (eta)
Zebrafish(192324) chaperonin containing TCP1, subunit 7 (eta)
cow(514355) chaperonin containing TCP1, subunit 7 (eta)
Horse(100050014) chaperonin containing TCP1, subunit 7 (eta)
domestic cat(101080777) chaperonin containing TCP1, subunit 7 (eta)
dog(610226) chaperonin containing TCP1, subunit 7 (eta)
chicken(428806) chaperonin containing TCP1, subunit 7 (eta)
sheep(101112301) chaperonin containing TCP1, subunit 7 (eta)
Domestic Rabbit(100009372) chaperonin containing TCP1, subunit 7 (eta)
naked mole-rat(101706370) chaperonin containing TCP1, subunit 7 (eta)
domestic guinea pig(100717550) chaperonin containing TCP1, subunit 7 (eta)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007638 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007638 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007638 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006429 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006429 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006429 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009570 Rosetta Predictions human pricing
NM_006429 Rosetta Predictions human pricing
NM_001106603 Rosetta Predictions rat pricing
NM_007638 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009570 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165876 predicted 584
2 SASI_Hs01_00165877 predicted 1018
3 SASI_Hs01_00165878 predicted 829
4 SASI_Hs01_00165879 predicted 340
5 SASI_Hs01_00165881 predicted 915
6 SASI_Hs01_00165882 predicted 967
7 SASI_Hs01_00165883 predicted 1014
8 SASI_Hs01_00165884 predicted 542
9 SASI_Hs01_00165885 predicted 971
10 SASI_Hs02_00305641 predicted 715
11 SASI_Hs01_00165880 predicted 846
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006429 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092317 predicted 1196
2 SASI_Hs01_00092318 predicted 1636
3 SASI_Hs01_00092319 predicted 1443
4 SASI_Hs01_00092320 predicted 957
5 SASI_Hs01_00092322 predicted 1522
6 SASI_Hs01_00092323 predicted 1584
7 SASI_Hs01_00092324 predicted 1633
8 SASI_Hs01_00092325 predicted 1152
9 SASI_Hs01_00092326 predicted 1581
10 SASI_Hs02_00341552 predicted 1325
11 SASI_Hs01_00092321 predicted 1461
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106603 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220578 predicted 1505
2 SASI_Rn02_00220579 predicted 1189
3 SASI_Rn02_00220580 predicted 1056
4 SASI_Rn02_00220581 predicted 739
5 SASI_Rn02_00220582 predicted 1700
6 SASI_Rn02_00220583 predicted 946
7 SASI_Rn02_00220584 predicted 2033
8 SASI_Rn02_00220585 predicted 1075
9 SASI_Rn02_00220586 predicted 1193
10 SASI_Rn02_00220587 predicted 1565
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007638 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182695 predicted 1289
2 SASI_Mm01_00182696 predicted 903
3 SASI_Mm02_00312116 predicted 1078
4 SASI_Mm01_00182690 predicted 383
5 SASI_Mm02_00312117 predicted 804
6 SASI_Mm02_00312118 predicted 1095
7 SASI_Mm02_00312119 predicted 247
8 SASI_Mm02_00312120 predicted 1184
9 SASI_Mm01_00182692 predicted 454
10 SASI_Mm02_00312121 predicted 775
11 SASI_Mm01_00182691 predicted 390
12 SASI_Mm01_00182693 predicted 1400
13 SASI_Mm01_00182694 predicted 912
14 SASI_Mm01_00182697 predicted 1317
15 SASI_Mm01_00182698 predicted 288
16 SASI_Mm01_00182699 predicted 1578
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007638
VALIDATED
CCT7 MISSION shRNA Bacterial Glycerol Stock
chaperonin containing TCP1, subunit 7 (eta)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353181    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007638.4-2294s21c1
Sequence:CCGGGATGAGAAGATGGTTGCTGGTCTCGAGACCAGCAACCATCTTCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007638.4-2162s21c1
Sequence:CCGGCGTGGATGAGACTATCAAGAACTCGAGTTCTTGATAGTCTCATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007638.4-1473s21c1
Sequence:CCGGGCCAAAGTCATCTTGTCTAAACTCGAGTTTAGACAAGATGACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120457    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007638.2-1727s1c1
Sequence:CCGGGATGAGAAGATGGTTGCTGGTCTCGAGACCAGCAACCATCTTCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007638.2-1595s1c1
Sequence:CCGGCGTGGATGAGACTATCAAGAACTCGAGTTCTTGATAGTCTCATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007638.2-1503s1c1
Sequence:CCGGGCCGACAACTTCCAGGCATTTCTCGAGAAATGCCTGGAAGTTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007638.2-906s1c1
Sequence:CCGGGCCAAAGTCATCTTGTCTAAACTCGAGTTTAGACAAGATGACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007638.2-177s1c1
Sequence:CCGGCGTGGCATGGACAAACTTATTCTCGAGAATAAGTTTGTCCATGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007638
VALIDATED
CCT7 MISSION shRNA shRNA Plasmid DNA
chaperonin containing TCP1, subunit 7 (eta)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353181    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007638.4-2294s21c1
Sequence:CCGGGATGAGAAGATGGTTGCTGGTCTCGAGACCAGCAACCATCTTCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007638.4-2162s21c1
Sequence:CCGGCGTGGATGAGACTATCAAGAACTCGAGTTCTTGATAGTCTCATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007638.4-1473s21c1
Sequence:CCGGGCCAAAGTCATCTTGTCTAAACTCGAGTTTAGACAAGATGACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120457    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007638.2-1727s1c1
Sequence:CCGGGATGAGAAGATGGTTGCTGGTCTCGAGACCAGCAACCATCTTCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007638.2-1595s1c1
Sequence:CCGGCGTGGATGAGACTATCAAGAACTCGAGTTCTTGATAGTCTCATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007638.2-1503s1c1
Sequence:CCGGGCCGACAACTTCCAGGCATTTCTCGAGAAATGCCTGGAAGTTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007638.2-906s1c1
Sequence:CCGGGCCAAAGTCATCTTGTCTAAACTCGAGTTTAGACAAGATGACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007638.2-177s1c1
Sequence:CCGGCGTGGCATGGACAAACTTATTCTCGAGAATAAGTTTGTCCATGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007638
VALIDATED
CCT7 MISSION shRNA Lentiviral Transduction Particles
chaperonin containing TCP1, subunit 7 (eta)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353181    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007638.4-2294s21c1
Sequence:CCGGGATGAGAAGATGGTTGCTGGTCTCGAGACCAGCAACCATCTTCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007638.4-2162s21c1
Sequence:CCGGCGTGGATGAGACTATCAAGAACTCGAGTTCTTGATAGTCTCATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007638.4-1473s21c1
Sequence:CCGGGCCAAAGTCATCTTGTCTAAACTCGAGTTTAGACAAGATGACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120457    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007638.2-1727s1c1
Sequence:CCGGGATGAGAAGATGGTTGCTGGTCTCGAGACCAGCAACCATCTTCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007638.2-1595s1c1
Sequence:CCGGCGTGGATGAGACTATCAAGAACTCGAGTTCTTGATAGTCTCATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007638.2-1503s1c1
Sequence:CCGGGCCGACAACTTCCAGGCATTTCTCGAGAAATGCCTGGAAGTTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007638.2-906s1c1
Sequence:CCGGGCCAAAGTCATCTTGTCTAAACTCGAGTTTAGACAAGATGACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007638.2-177s1c1
Sequence:CCGGCGTGGCATGGACAAACTTATTCTCGAGAATAAGTTTGTCCATGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006429
VALIDATED
CCT7 MISSION shRNA Bacterial Glycerol Stock
chaperonin containing TCP1, subunit 7 (eta)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006429.2-289s21c1
Sequence:CCGGGCCACAATTCTGAAACTTCTTCTCGAGAAGAAGTTTCAGAATTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006429.2-907s21c1
Sequence:CCGGGCTGAGTGGAACATTCTCTATCTCGAGATAGAGAATGTTCCACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_006429.2-958s21c1
Sequence:CCGGGCCAAAGTTGTCTTGTCCAAACTCGAGTTTGGACAAGACAACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006429.2-328s21c1
Sequence:CCGGGCAAAGACTTTGGTAGACATTCTCGAGAATGTCTACCAAAGTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006429.1-924s1c1
Sequence:CCGGGCCAAAGTTGTCTTGTCCAAACTCGAGTTTGGACAAGACAACTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006429.1-223s1c1
Sequence:CCGGGCAGAGGCAAAGCAACAATTTCTCGAGAAATTGTTGCTTTGCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006429.1-294s1c1
Sequence:CCGGGCAAAGACTTTGGTAGACATTCTCGAGAATGTCTACCAAAGTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006429.1-873s1c1
Sequence:CCGGGCTGAGTGGAACATTCTCTATCTCGAGATAGAGAATGTTCCACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006429.1-255s1c1
Sequence:CCGGGCCACAATTCTGAAACTTCTTCTCGAGAAGAAGTTTCAGAATTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006429
VALIDATED
CCT7 MISSION shRNA shRNA Plasmid DNA
chaperonin containing TCP1, subunit 7 (eta)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006429.2-289s21c1
Sequence:CCGGGCCACAATTCTGAAACTTCTTCTCGAGAAGAAGTTTCAGAATTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006429.2-907s21c1
Sequence:CCGGGCTGAGTGGAACATTCTCTATCTCGAGATAGAGAATGTTCCACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_006429.2-958s21c1
Sequence:CCGGGCCAAAGTTGTCTTGTCCAAACTCGAGTTTGGACAAGACAACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006429.2-328s21c1
Sequence:CCGGGCAAAGACTTTGGTAGACATTCTCGAGAATGTCTACCAAAGTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006429.1-924s1c1
Sequence:CCGGGCCAAAGTTGTCTTGTCCAAACTCGAGTTTGGACAAGACAACTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006429.1-223s1c1
Sequence:CCGGGCAGAGGCAAAGCAACAATTTCTCGAGAAATTGTTGCTTTGCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006429.1-294s1c1
Sequence:CCGGGCAAAGACTTTGGTAGACATTCTCGAGAATGTCTACCAAAGTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006429.1-873s1c1
Sequence:CCGGGCTGAGTGGAACATTCTCTATCTCGAGATAGAGAATGTTCCACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006429.1-255s1c1
Sequence:CCGGGCCACAATTCTGAAACTTCTTCTCGAGAAGAAGTTTCAGAATTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006429
VALIDATED
CCT7 MISSION shRNA Lentiviral Transduction Particles
chaperonin containing TCP1, subunit 7 (eta)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006429.2-289s21c1
Sequence:CCGGGCCACAATTCTGAAACTTCTTCTCGAGAAGAAGTTTCAGAATTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006429.2-907s21c1
Sequence:CCGGGCTGAGTGGAACATTCTCTATCTCGAGATAGAGAATGTTCCACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_006429.2-958s21c1
Sequence:CCGGGCCAAAGTTGTCTTGTCCAAACTCGAGTTTGGACAAGACAACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006429.2-328s21c1
Sequence:CCGGGCAAAGACTTTGGTAGACATTCTCGAGAATGTCTACCAAAGTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006429.1-924s1c1
Sequence:CCGGGCCAAAGTTGTCTTGTCCAAACTCGAGTTTGGACAAGACAACTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006429.1-223s1c1
Sequence:CCGGGCAGAGGCAAAGCAACAATTTCTCGAGAAATTGTTGCTTTGCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006429.1-294s1c1
Sequence:CCGGGCAAAGACTTTGGTAGACATTCTCGAGAATGTCTACCAAAGTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006429.1-873s1c1
Sequence:CCGGGCTGAGTGGAACATTCTCTATCTCGAGATAGAGAATGTTCCACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006429.1-255s1c1
Sequence:CCGGGCCACAATTCTGAAACTTCTTCTCGAGAAGAAGTTTCAGAATTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks