EMAIL THIS PAGE TO A FRIEND

CCT8

chaperonin containing TCP1, subunit 8 (theta)

60 Gene Product Result for
Synonyms: C21orf112 Cctq D21S246 PRED71
UniProtKB ID: P50990, A6NN54, Q4VBP8
Gene ID:
Mouse(12469) chaperonin containing Tcp1, subunit 8 (theta)
Rat(288305) chaperonin containing Tcp1, subunit 8 (theta)
Zebrafish(394037) chaperonin containing TCP1, subunit 8 (theta)
chicken(418486) chaperonin containing TCP1, subunit 8 (theta)
cow(281047) chaperonin containing TCP1, subunit 8 (theta)
domestic cat(101097910) chaperonin containing TCP1, subunit 8 (theta)
dog(478399) chaperonin containing TCP1, subunit 8 (theta)
domestic guinea pig(100713457) chaperonin containing TCP1, subunit 8 (theta)
naked mole-rat(101702492) chaperonin containing TCP1, subunit 8 (theta)
sheep(101108792) chaperonin containing TCP1, subunit 8 (theta)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006585 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006585 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006585 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009840 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009840 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009840 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006585 Rosetta Predictions human pricing
NM_001105897 Rosetta Predictions rat pricing
NM_009840 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006585 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066978 predicted 1411
2 SASI_Hs01_00066979 predicted 1384
3 SASI_Hs01_00066981 predicted 587
4 SASI_Hs01_00066982 predicted 816
5 SASI_Hs02_00341881 predicted 964
6 SASI_Hs01_00066983 predicted 1167
7 SASI_Hs02_00341882 predicted 1216
8 SASI_Hs02_00341883 predicted 595
9 SASI_Hs01_00066987 predicted 1349
10 SASI_Hs02_00341884 predicted 666
11 SASI_Hs01_00066980 predicted 206
12 SASI_Hs01_00066984 predicted 698
13 SASI_Hs01_00066985 predicted 751
14 SASI_Hs01_00066986 predicted 734
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105897 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213612 predicted 454
2 SASI_Rn02_00213613 predicted 723
3 SASI_Rn02_00213614 predicted 896
4 SASI_Rn02_00213615 predicted 1220
5 SASI_Rn02_00213616 predicted 956
6 SASI_Rn02_00213617 predicted 865
7 SASI_Rn02_00213618 predicted 1461
8 SASI_Rn02_00213619 predicted 704
9 SASI_Rn02_00213620 predicted 655
10 SASI_Rn02_00213621 predicted 274
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009840 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073486 predicted 1829
2 SASI_Mm01_00073487 predicted 447
3 SASI_Mm01_00073488 predicted 721
4 SASI_Mm01_00073489 predicted 1144
5 SASI_Mm01_00073490 predicted 565
6 SASI_Mm01_00073491 predicted 757
7 SASI_Mm01_00073492 predicted 959
8 SASI_Mm01_00073493 predicted 614
9 SASI_Mm01_00073495 predicted 791
10 SASI_Mm02_00317198 predicted 672
11 SASI_Mm01_00073494 predicted 317
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006585
CCT8 MISSION shRNA Bacterial Glycerol Stock
chaperonin containing TCP1, subunit 8 (theta)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000152385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006585.2-1357s1c1
Sequence:CCGGGCCAAACAGATCACATCATATCTCGAGATATGATGTGATCTGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006585.2-296s1c1
Sequence:CCGGCAAACGATGCAGCAACTATTTCTCGAGAAATAGTTGCTGCATCGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006585.2-178s1c1
Sequence:CCGGGAGGCTGTGTATAGAAACATACTCGAGTATGTTTCTATACACAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006585.2-868s1c1
Sequence:CCGGGTGTTGATAAAGACTGCTGAACTCGAGTTCAGCAGTCTTTATCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183655    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006585.2-1271s1c1
Sequence:CCGGCAGTAGACGATGGTGTTAATACTCGAGTATTAACACCATCGTCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006585.2-1477s1c1
Sequence:CCGGGCCAATGAAGTAATCTCTAAACTCGAGTTTAGAGATTACTTCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006585.2-398s1c1
Sequence:CCGGGCACAAACTTTGTTCTGGTATCTCGAGATACCAGAACAAAGTTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006585.2-649s21c1
Sequence:CCGGGCTCAGGCATGCGTATCTATTCTCGAGAATAGATACGCATGCCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006585.2-1270s21c1
Sequence:CCGGGCAGTAGACGATGGTGTTAATCTCGAGATTAACACCATCGTCTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006585.2-1394s21c1
Sequence:CCGGGACTTGAACAGTATGCTATTACTCGAGTAATAGCATACTGTTCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006585.2-592s21c1
Sequence:CCGGCGTACCTCCATAATGAGTAAACTCGAGTTTACTCATTATGGAGGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006585.2-1571s21c1
Sequence:CCGGACATGCTGGAAGCTGGTATTCCTCGAGGAATACCAGCTTCCAGCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006585
CCT8 MISSION shRNA shRNA Plasmid DNA
chaperonin containing TCP1, subunit 8 (theta)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000152385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006585.2-1357s1c1
Sequence:CCGGGCCAAACAGATCACATCATATCTCGAGATATGATGTGATCTGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006585.2-296s1c1
Sequence:CCGGCAAACGATGCAGCAACTATTTCTCGAGAAATAGTTGCTGCATCGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006585.2-178s1c1
Sequence:CCGGGAGGCTGTGTATAGAAACATACTCGAGTATGTTTCTATACACAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006585.2-868s1c1
Sequence:CCGGGTGTTGATAAAGACTGCTGAACTCGAGTTCAGCAGTCTTTATCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183655    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006585.2-1271s1c1
Sequence:CCGGCAGTAGACGATGGTGTTAATACTCGAGTATTAACACCATCGTCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006585.2-1477s1c1
Sequence:CCGGGCCAATGAAGTAATCTCTAAACTCGAGTTTAGAGATTACTTCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006585.2-398s1c1
Sequence:CCGGGCACAAACTTTGTTCTGGTATCTCGAGATACCAGAACAAAGTTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006585.2-649s21c1
Sequence:CCGGGCTCAGGCATGCGTATCTATTCTCGAGAATAGATACGCATGCCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006585.2-1270s21c1
Sequence:CCGGGCAGTAGACGATGGTGTTAATCTCGAGATTAACACCATCGTCTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006585.2-1394s21c1
Sequence:CCGGGACTTGAACAGTATGCTATTACTCGAGTAATAGCATACTGTTCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006585.2-592s21c1
Sequence:CCGGCGTACCTCCATAATGAGTAAACTCGAGTTTACTCATTATGGAGGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006585.2-1571s21c1
Sequence:CCGGACATGCTGGAAGCTGGTATTCCTCGAGGAATACCAGCTTCCAGCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006585
CCT8 MISSION shRNA Lentiviral Transduction Particles
chaperonin containing TCP1, subunit 8 (theta)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000152385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006585.2-1357s1c1
Sequence:CCGGGCCAAACAGATCACATCATATCTCGAGATATGATGTGATCTGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006585.2-296s1c1
Sequence:CCGGCAAACGATGCAGCAACTATTTCTCGAGAAATAGTTGCTGCATCGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006585.2-178s1c1
Sequence:CCGGGAGGCTGTGTATAGAAACATACTCGAGTATGTTTCTATACACAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006585.2-868s1c1
Sequence:CCGGGTGTTGATAAAGACTGCTGAACTCGAGTTCAGCAGTCTTTATCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183655    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006585.2-1271s1c1
Sequence:CCGGCAGTAGACGATGGTGTTAATACTCGAGTATTAACACCATCGTCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006585.2-1477s1c1
Sequence:CCGGGCCAATGAAGTAATCTCTAAACTCGAGTTTAGAGATTACTTCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006585.2-398s1c1
Sequence:CCGGGCACAAACTTTGTTCTGGTATCTCGAGATACCAGAACAAAGTTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006585.2-649s21c1
Sequence:CCGGGCTCAGGCATGCGTATCTATTCTCGAGAATAGATACGCATGCCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006585.2-1270s21c1
Sequence:CCGGGCAGTAGACGATGGTGTTAATCTCGAGATTAACACCATCGTCTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006585.2-1394s21c1
Sequence:CCGGGACTTGAACAGTATGCTATTACTCGAGTAATAGCATACTGTTCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006585.2-592s21c1
Sequence:CCGGCGTACCTCCATAATGAGTAAACTCGAGTTTACTCATTATGGAGGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006585.2-1571s21c1
Sequence:CCGGACATGCTGGAAGCTGGTATTCCTCGAGGAATACCAGCTTCCAGCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009840
VALIDATED
CCT8 MISSION shRNA Bacterial Glycerol Stock
chaperonin containing TCP1, subunit 8 (theta)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120472    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009840.2-1835s1c1
Sequence:CCGGCGTCTGTTTAATCACTCACATCTCGAGATGTGAGTGATTAAACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009840.2-211s1c1
Sequence:CCGGCGGACCAAATGGAATGAATAACTCGAGTTATTCATTCCATTTGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009840.2-1532s1c1
Sequence:CCGGGCTGTAAAGGATATGTTAGAACTCGAGTTCTAACATATCCTTTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009840.2-962s1c1
Sequence:CCGGGCGGACATAGCTCTTCATTATCTCGAGATAATGAAGAGCTATGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009840.2-413s1c1
Sequence:CCGGGCTGAAGAACTTCTGAGGATTCTCGAGAATCCTCAGAAGTTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009840.3-1543s21c1
Sequence:CCGGGCTGTAAAGGATATGTTAGAACTCGAGTTCTAACATATCCTTTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009840.3-222s21c1
Sequence:CCGGCGGACCAAATGGAATGAATAACTCGAGTTATTCATTCCATTTGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009840.3-973s21c1
Sequence:CCGGGCGGACATAGCTCTTCATTATCTCGAGATAATGAAGAGCTATGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009840.3-424s21c1
Sequence:CCGGGCTGAAGAACTTCTGAGGATTCTCGAGAATCCTCAGAAGTTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009840
VALIDATED
CCT8 MISSION shRNA shRNA Plasmid DNA
chaperonin containing TCP1, subunit 8 (theta)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120472    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009840.2-1835s1c1
Sequence:CCGGCGTCTGTTTAATCACTCACATCTCGAGATGTGAGTGATTAAACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009840.2-211s1c1
Sequence:CCGGCGGACCAAATGGAATGAATAACTCGAGTTATTCATTCCATTTGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009840.2-1532s1c1
Sequence:CCGGGCTGTAAAGGATATGTTAGAACTCGAGTTCTAACATATCCTTTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009840.2-962s1c1
Sequence:CCGGGCGGACATAGCTCTTCATTATCTCGAGATAATGAAGAGCTATGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009840.2-413s1c1
Sequence:CCGGGCTGAAGAACTTCTGAGGATTCTCGAGAATCCTCAGAAGTTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009840.3-1543s21c1
Sequence:CCGGGCTGTAAAGGATATGTTAGAACTCGAGTTCTAACATATCCTTTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009840.3-222s21c1
Sequence:CCGGCGGACCAAATGGAATGAATAACTCGAGTTATTCATTCCATTTGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009840.3-973s21c1
Sequence:CCGGGCGGACATAGCTCTTCATTATCTCGAGATAATGAAGAGCTATGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009840.3-424s21c1
Sequence:CCGGGCTGAAGAACTTCTGAGGATTCTCGAGAATCCTCAGAAGTTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009840
VALIDATED
CCT8 MISSION shRNA Lentiviral Transduction Particles
chaperonin containing TCP1, subunit 8 (theta)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120472    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009840.2-1835s1c1
Sequence:CCGGCGTCTGTTTAATCACTCACATCTCGAGATGTGAGTGATTAAACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009840.2-211s1c1
Sequence:CCGGCGGACCAAATGGAATGAATAACTCGAGTTATTCATTCCATTTGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009840.2-1532s1c1
Sequence:CCGGGCTGTAAAGGATATGTTAGAACTCGAGTTCTAACATATCCTTTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009840.2-962s1c1
Sequence:CCGGGCGGACATAGCTCTTCATTATCTCGAGATAATGAAGAGCTATGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009840.2-413s1c1
Sequence:CCGGGCTGAAGAACTTCTGAGGATTCTCGAGAATCCTCAGAAGTTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009840.3-1543s21c1
Sequence:CCGGGCTGTAAAGGATATGTTAGAACTCGAGTTCTAACATATCCTTTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009840.3-222s21c1
Sequence:CCGGCGGACCAAATGGAATGAATAACTCGAGTTATTCATTCCATTTGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009840.3-973s21c1
Sequence:CCGGGCGGACATAGCTCTTCATTATCTCGAGATAATGAAGAGCTATGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009840.3-424s21c1
Sequence:CCGGGCTGAAGAACTTCTGAGGATTCTCGAGAATCCTCAGAAGTTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks