EMAIL THIS PAGE TO A FRIEND

CCT8L1P

chaperonin containing TCP1, subunit 8 (theta)-like 1, pseudogene

4 Gene Product Result for
Synonyms: CCT8L1
Species: Human CCT8L1P(155100)
UniProtKB ID: A6NM43
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001029866 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001029866 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001029866 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001029866 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029866 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193175 predicted 1613
2 SASI_Hs01_00193176 predicted 1614
3 SASI_Hs01_00193177 predicted 509
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001029866
CCT8L1P MISSION shRNA Bacterial Glycerol Stock
chaperonin containing TCP1, subunit 8 (theta)-like 1, pseudogene
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029866.1-1485s1c1
Sequence:CCGGCCACAGAAATGGCTTTGGCAACTCGAGTTGCCAAAGCCATTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029866.1-1837s1c1
Sequence:CCGGGATCTGGAATCCTGACTCTAACTCGAGTTAGAGTCAGGATTCCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161004    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029866.1-1783s1c1
Sequence:CCGGGCTCGTGACTGTAGATGAAATCTCGAGATTTCATCTACAGTCACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163303    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029866.1-1436s1c1
Sequence:CCGGGCCTATTTCCAGCCATGTCAACTCGAGTTGACATGGCTGGAAATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029866.1-1322s1c1
Sequence:CCGGGCTGTGGTATTTGAATGGGAACTCGAGTTCCCATTCAAATACCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029866.1-429s1c1
Sequence:CCGGCCATGAAAGGAGAAACAGTGTCTCGAGACACTGTTTCTCCTTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001029866
CCT8L1P MISSION shRNA shRNA Plasmid DNA
chaperonin containing TCP1, subunit 8 (theta)-like 1, pseudogene
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029866.1-1485s1c1
Sequence:CCGGCCACAGAAATGGCTTTGGCAACTCGAGTTGCCAAAGCCATTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029866.1-1837s1c1
Sequence:CCGGGATCTGGAATCCTGACTCTAACTCGAGTTAGAGTCAGGATTCCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161004    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029866.1-1783s1c1
Sequence:CCGGGCTCGTGACTGTAGATGAAATCTCGAGATTTCATCTACAGTCACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163303    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029866.1-1436s1c1
Sequence:CCGGGCCTATTTCCAGCCATGTCAACTCGAGTTGACATGGCTGGAAATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029866.1-1322s1c1
Sequence:CCGGGCTGTGGTATTTGAATGGGAACTCGAGTTCCCATTCAAATACCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029866.1-429s1c1
Sequence:CCGGCCATGAAAGGAGAAACAGTGTCTCGAGACACTGTTTCTCCTTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001029866
CCT8L1P MISSION shRNA Lentiviral Transduction Particles
chaperonin containing TCP1, subunit 8 (theta)-like 1, pseudogene
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029866.1-1485s1c1
Sequence:CCGGCCACAGAAATGGCTTTGGCAACTCGAGTTGCCAAAGCCATTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029866.1-1837s1c1
Sequence:CCGGGATCTGGAATCCTGACTCTAACTCGAGTTAGAGTCAGGATTCCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161004    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029866.1-1783s1c1
Sequence:CCGGGCTCGTGACTGTAGATGAAATCTCGAGATTTCATCTACAGTCACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163303    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029866.1-1436s1c1
Sequence:CCGGGCCTATTTCCAGCCATGTCAACTCGAGTTGACATGGCTGGAAATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029866.1-1322s1c1
Sequence:CCGGGCTGTGGTATTTGAATGGGAACTCGAGTTCCCATTCAAATACCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029866.1-429s1c1
Sequence:CCGGCCATGAAAGGAGAAACAGTGTCTCGAGACACTGTTTCTCCTTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks