EMAIL THIS PAGE TO A FRIEND

CCT8L2

chaperonin containing TCP1, subunit 8 (theta)-like 2

46 Gene Product Result for
Synonyms: CESK1
UniProtKB ID: Q96SF2, A4QPH3, Q9UJS3
Gene ID:
dog(482811) chaperonin containing TCP1, subunit 8 (theta)-like 2
cow(618575) chaperonin containing TCP1, subunit 8 (theta)-like 2
Domestic Rabbit(100353934) chaperonin containing TCP1, subunit 8 (theta)-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1408379 Anti-CCT8L2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2100375 Anti-CCT8L2 antibody produced in rabbit affinity isolated antibody guinea pig, human, rabbit
western blot pricing
HPA045440 Anti-CCT8L2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA039268 Anti-CCT8L2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA041336 Anti-CCT8L2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1410264 Anti-CCT8L2 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1411791 ANTI-CESK1 antibody produced in mouse clone 2C9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1405369 Monoclonal Anti-CCT8L2 antibody produced in mouse clone 1G8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB4100530 Monoclonal Anti-CCT8L2 antibody produced in mouse clone CCT8L2-B478, culture supernatant human
western blot pricing
WH0150160M1 Monoclonal Anti-CESK1 antibody produced in mouse clone 4G6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014406 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014406 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014406 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU110541 MISSION® esiRNA esiRNA human CESK1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014406 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014406 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345594 predicted 1641
2 SASI_Hs01_00209205 predicted 1190
3 SASI_Hs02_00345595 predicted 1073
4 SASI_Hs02_00345596 predicted 537
5 SASI_Hs01_00209196 predicted 1051
6 SASI_Hs01_00209197 predicted 577
7 SASI_Hs01_00209198 predicted 1033
8 SASI_Hs01_00209199 predicted 1334
9 SASI_Hs01_00209200 predicted 1437
10 SASI_Hs01_00209201 predicted 1219
11 SASI_Hs01_00209202 predicted 1186
12 SASI_Hs01_00209203 predicted 835
13 SASI_Hs01_00209204 predicted 953
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014406
CCT8L2 MISSION shRNA Bacterial Glycerol Stock
chaperonin containing TCP1, subunit 8 (theta)-like 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014406.3-1866s1c1
Sequence:CCGGGACTCCAAGAAGACAAAGAAACTCGAGTTTCTTTGTCTTCTTGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014406.3-1338s1c1
Sequence:CCGGGCTGTGGTATTTGAATGGGAACTCGAGTTCCCATTCAAATACCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014406.3-1799s1c1
Sequence:CCGGGCTCGTGACTGTAGATGAAATCTCGAGATTTCATCTACAGTCACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014406.3-1452s1c1
Sequence:CCGGGCCTATTTCCAGCTATGTCAACTCGAGTTGACATAGCTGGAAATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014406.3-1501s1c1
Sequence:CCGGCCACAGAAATGGCTTTGGCAACTCGAGTTGCCAAAGCCATTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140475    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014406.3-1853s1c1
Sequence:CCGGGATCTGGAATCCTGACTCCAACTCGAGTTGGAGTCAGGATTCCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014406.3-1631s1c1
Sequence:CCGGCTTAGCTGTCTCAGACGTGATCTCGAGATCACGTCTGAGACAGCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014406.3-1439s1c1
Sequence:CCGGCCACGGCATTGATGCCTATTTCTCGAGAAATAGGCATCAATGCCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014406.3-1815s1c1
Sequence:CCGGGAAATCGTAGTGGCCAAGAAACTCGAGTTTCTTGGCCACTACGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014406
CCT8L2 MISSION shRNA shRNA Plasmid DNA
chaperonin containing TCP1, subunit 8 (theta)-like 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014406.3-1866s1c1
Sequence:CCGGGACTCCAAGAAGACAAAGAAACTCGAGTTTCTTTGTCTTCTTGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014406.3-1338s1c1
Sequence:CCGGGCTGTGGTATTTGAATGGGAACTCGAGTTCCCATTCAAATACCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014406.3-1799s1c1
Sequence:CCGGGCTCGTGACTGTAGATGAAATCTCGAGATTTCATCTACAGTCACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014406.3-1452s1c1
Sequence:CCGGGCCTATTTCCAGCTATGTCAACTCGAGTTGACATAGCTGGAAATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014406.3-1501s1c1
Sequence:CCGGCCACAGAAATGGCTTTGGCAACTCGAGTTGCCAAAGCCATTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140475    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014406.3-1853s1c1
Sequence:CCGGGATCTGGAATCCTGACTCCAACTCGAGTTGGAGTCAGGATTCCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014406.3-1631s1c1
Sequence:CCGGCTTAGCTGTCTCAGACGTGATCTCGAGATCACGTCTGAGACAGCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014406.3-1439s1c1
Sequence:CCGGCCACGGCATTGATGCCTATTTCTCGAGAAATAGGCATCAATGCCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014406.3-1815s1c1
Sequence:CCGGGAAATCGTAGTGGCCAAGAAACTCGAGTTTCTTGGCCACTACGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014406
CCT8L2 MISSION shRNA Lentiviral Transduction Particles
chaperonin containing TCP1, subunit 8 (theta)-like 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014406.3-1866s1c1
Sequence:CCGGGACTCCAAGAAGACAAAGAAACTCGAGTTTCTTTGTCTTCTTGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014406.3-1338s1c1
Sequence:CCGGGCTGTGGTATTTGAATGGGAACTCGAGTTCCCATTCAAATACCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014406.3-1799s1c1
Sequence:CCGGGCTCGTGACTGTAGATGAAATCTCGAGATTTCATCTACAGTCACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014406.3-1452s1c1
Sequence:CCGGGCCTATTTCCAGCTATGTCAACTCGAGTTGACATAGCTGGAAATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014406.3-1501s1c1
Sequence:CCGGCCACAGAAATGGCTTTGGCAACTCGAGTTGCCAAAGCCATTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140475    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014406.3-1853s1c1
Sequence:CCGGGATCTGGAATCCTGACTCCAACTCGAGTTGGAGTCAGGATTCCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014406.3-1631s1c1
Sequence:CCGGCTTAGCTGTCTCAGACGTGATCTCGAGATCACGTCTGAGACAGCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014406.3-1439s1c1
Sequence:CCGGCCACGGCATTGATGCCTATTTCTCGAGAAATAGGCATCAATGCCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014406.3-1815s1c1
Sequence:CCGGGAAATCGTAGTGGCCAAGAAACTCGAGTTTCTTGGCCACTACGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks