EMAIL THIS PAGE TO A FRIEND

CCZ1

CCZ1 vacuolar protein trafficking and biogenesis associated homolog (S. cerevisiae)

56 Gene Product Result for
Synonyms: C7orf28A CCZ1A H_DJ1163J12.2
UniProtKB ID: P86791, A2RU45, O95766, Q9UG65, Q9Y359
Gene ID:
Mouse(231874) CCZ1 vacuolar protein trafficking and biogenesis associated
Rat(360768) CCZ1 vacuolar protein trafficking and biogenesis associated homolog (S. cerevisiae)
Zebrafish(393103) CCZ1 vacuolar protein trafficking and biogenesis associated homolog (S. cerevisiae)
dog(479750) CCZ1 vacuolar protein trafficking and biogenesis associated homolog (S. cerevisiae)
cow(511088) CCZ1 vacuolar protein trafficking and biogenesis associated homolog (S. cerevisiae)
domestic cat(101097288) CCZ1 vacuolar protein trafficking and biogenesis associated homolog (S. cerevisiae)
chicken(416433) CCZ1 vacuolar protein trafficking and biogenesis associated homolog (S. cerevisiae)
naked mole-rat(101714581) CCZ1 vacuolar protein trafficking and biogenesis associated homolog (S. cerevisiae)
domestic guinea pig(100725654) CCZ1 vacuolar protein trafficking and biogenesis associated homolog (S. cerevisiae)
sheep(101115090) CCZ1 vacuolar protein trafficking and biogenesis associated homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015622 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015622 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015622 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177682 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177682 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177682 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU004101 MISSION® esiRNA esiRNA targeting mouse AU022870 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015622 Rosetta Predictions human pricing
NM_001014126 Rosetta Predictions rat pricing
NM_177682 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015622 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243195 predicted 951
2 SASI_Hs01_00243196 predicted 953
3 SASI_Hs01_00243197 predicted 1231
4 SASI_Hs01_00243199 predicted 862
5 SASI_Hs01_00243200 predicted 1460
6 SASI_Hs01_00243201 predicted 1387
7 SASI_Hs01_00243202 predicted 1226
8 SASI_Hs01_00243203 predicted 849
9 SASI_Hs02_00348215 predicted 1589
10 SASI_Hs02_00348216 predicted 1253
11 SASI_Hs01_00243198 predicted 598
12 SASI_Hs01_00243204 predicted 934
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014126 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081845 predicted 612
2 SASI_Rn01_00081846 predicted 871
3 SASI_Rn01_00081847 predicted 904
4 SASI_Rn01_00081848 predicted 707
5 SASI_Rn01_00081849 predicted 968
6 SASI_Rn01_00081850 predicted 931
7 SASI_Rn01_00081851 predicted 265
8 SASI_Rn01_00081852 predicted 919
9 SASI_Rn01_00081853 predicted 566
10 SASI_Rn01_00081854 predicted 687
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177682 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092931 predicted 958
2 SASI_Mm01_00092932 predicted 1516
3 SASI_Mm01_00092933 predicted 744
4 SASI_Mm01_00092934 predicted 888
5 SASI_Mm01_00092936 predicted 535
6 SASI_Mm01_00092937 predicted 603
7 SASI_Mm01_00092938 predicted 228
8 SASI_Mm01_00092939 predicted 1101
9 SASI_Mm01_00092940 predicted 860
10 SASI_Mm02_00348011 predicted 574
11 SASI_Mm01_00092935 predicted 586
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015622
VALIDATED
CCZ1 MISSION shRNA Bacterial Glycerol Stock
CCZ1 vacuolar protein trafficking and biogenesis associated homolog (S. cerevisiae)
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000129615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_015622.4-713s1c1
Sequence:CCGGCAGCTTCTTCCCGTTGGATAACTCGAGTTATCCAACGGGAAGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015622.4-951s1c1
Sequence:CCGGCCAGGAAATCTTCAACACTATCTCGAGATAGTGTTGAAGATTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015622.4-1404s1c1
Sequence:CCGGGATGAAGATGAGGAGATCATTCTCGAGAATGATCTCCTCATCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_015622.4-1553s1c1
Sequence:CCGGGCAGTTCAACAACATCTTCTTCTCGAGAAGAAGATGTTGTTGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_015622.4-927s1c1
Sequence:CCGGGATTCTCCAATAAGAGCAGAACTCGAGTTCTGCTCTTATTGGAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015622.4-206s1c1
Sequence:CCGGGCTGAGTTTCTTCATCTACAACTCGAGTTGTAGATGAAGAAACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015622.4-349s1c1
Sequence:CCGGCAAGGACATTTAGCCCATCAACTCGAGTTGATGGGCTAAATGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015622.4-1295s1c1
Sequence:CCGGCGAGAAGAGCACAGTTCACATCTCGAGATGTGAACTGTGCTCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015622.5-597s21c1
Sequence:CCGGGAAATTCTTCCATCGGTATTTCTCGAGAAATACCGATGGAAGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015622.5-401s21c1
Sequence:CCGGTGGTTGTTCGGAATCCTATAACTCGAGTTATAGGATTCCGAACAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015622.5-1361s21c1
Sequence:CCGGATGAAGATGAGGAGATCATTGCTCGAGCAATGATCTCCTCATCTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015622.5-1737s21c1
Sequence:CCGGTTGGCTATATCGCTATCATTTCTCGAGAAATGATAGCGATATAGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015622.5-1021s21c1
Sequence:CCGGGAGCTCCATTTAATCGTTTATCTCGAGATAAACGATTAAATGGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015622.5-1586s21c1
Sequence:CCGGATTTGGTCACATGCAAGTTAGCTCGAGCTAACTTGCATGTGACCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426583    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015622.5-1624s21c1
Sequence:CCGGGCATTCAGGACAAGGGTAAAGCTCGAGCTTTACCCTTGTCCTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015622
VALIDATED
CCZ1 MISSION shRNA shRNA Plasmid DNA
CCZ1 vacuolar protein trafficking and biogenesis associated homolog (S. cerevisiae)
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000129615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_015622.4-713s1c1
Sequence:CCGGCAGCTTCTTCCCGTTGGATAACTCGAGTTATCCAACGGGAAGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015622.4-951s1c1
Sequence:CCGGCCAGGAAATCTTCAACACTATCTCGAGATAGTGTTGAAGATTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015622.4-1404s1c1
Sequence:CCGGGATGAAGATGAGGAGATCATTCTCGAGAATGATCTCCTCATCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_015622.4-1553s1c1
Sequence:CCGGGCAGTTCAACAACATCTTCTTCTCGAGAAGAAGATGTTGTTGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_015622.4-927s1c1
Sequence:CCGGGATTCTCCAATAAGAGCAGAACTCGAGTTCTGCTCTTATTGGAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015622.4-206s1c1
Sequence:CCGGGCTGAGTTTCTTCATCTACAACTCGAGTTGTAGATGAAGAAACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015622.4-349s1c1
Sequence:CCGGCAAGGACATTTAGCCCATCAACTCGAGTTGATGGGCTAAATGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015622.4-1295s1c1
Sequence:CCGGCGAGAAGAGCACAGTTCACATCTCGAGATGTGAACTGTGCTCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015622.5-597s21c1
Sequence:CCGGGAAATTCTTCCATCGGTATTTCTCGAGAAATACCGATGGAAGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015622.5-401s21c1
Sequence:CCGGTGGTTGTTCGGAATCCTATAACTCGAGTTATAGGATTCCGAACAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015622.5-1361s21c1
Sequence:CCGGATGAAGATGAGGAGATCATTGCTCGAGCAATGATCTCCTCATCTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015622.5-1737s21c1
Sequence:CCGGTTGGCTATATCGCTATCATTTCTCGAGAAATGATAGCGATATAGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015622.5-1021s21c1
Sequence:CCGGGAGCTCCATTTAATCGTTTATCTCGAGATAAACGATTAAATGGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015622.5-1586s21c1
Sequence:CCGGATTTGGTCACATGCAAGTTAGCTCGAGCTAACTTGCATGTGACCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426583    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015622.5-1624s21c1
Sequence:CCGGGCATTCAGGACAAGGGTAAAGCTCGAGCTTTACCCTTGTCCTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015622
VALIDATED
CCZ1 MISSION shRNA Lentiviral Transduction Particles
CCZ1 vacuolar protein trafficking and biogenesis associated homolog (S. cerevisiae)
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000129615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_015622.4-713s1c1
Sequence:CCGGCAGCTTCTTCCCGTTGGATAACTCGAGTTATCCAACGGGAAGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015622.4-951s1c1
Sequence:CCGGCCAGGAAATCTTCAACACTATCTCGAGATAGTGTTGAAGATTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015622.4-1404s1c1
Sequence:CCGGGATGAAGATGAGGAGATCATTCTCGAGAATGATCTCCTCATCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_015622.4-1553s1c1
Sequence:CCGGGCAGTTCAACAACATCTTCTTCTCGAGAAGAAGATGTTGTTGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_015622.4-927s1c1
Sequence:CCGGGATTCTCCAATAAGAGCAGAACTCGAGTTCTGCTCTTATTGGAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015622.4-206s1c1
Sequence:CCGGGCTGAGTTTCTTCATCTACAACTCGAGTTGTAGATGAAGAAACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015622.4-349s1c1
Sequence:CCGGCAAGGACATTTAGCCCATCAACTCGAGTTGATGGGCTAAATGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015622.4-1295s1c1
Sequence:CCGGCGAGAAGAGCACAGTTCACATCTCGAGATGTGAACTGTGCTCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015622.5-597s21c1
Sequence:CCGGGAAATTCTTCCATCGGTATTTCTCGAGAAATACCGATGGAAGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015622.5-401s21c1
Sequence:CCGGTGGTTGTTCGGAATCCTATAACTCGAGTTATAGGATTCCGAACAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015622.5-1361s21c1
Sequence:CCGGATGAAGATGAGGAGATCATTGCTCGAGCAATGATCTCCTCATCTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015622.5-1737s21c1
Sequence:CCGGTTGGCTATATCGCTATCATTTCTCGAGAAATGATAGCGATATAGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015622.5-1021s21c1
Sequence:CCGGGAGCTCCATTTAATCGTTTATCTCGAGATAAACGATTAAATGGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015622.5-1586s21c1
Sequence:CCGGATTTGGTCACATGCAAGTTAGCTCGAGCTAACTTGCATGTGACCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426583    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015622.5-1624s21c1
Sequence:CCGGGCATTCAGGACAAGGGTAAAGCTCGAGCTTTACCCTTGTCCTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177682
VALIDATED
CCZ1 MISSION shRNA Bacterial Glycerol Stock
CCZ1 vacuolar protein trafficking and biogenesis associated homolog (S. cerevisiae)
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177682.3-452s1c1
Sequence:CCGGGCAGTGCTACAGCATGTACAACTCGAGTTGTACATGCTGTAGCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177682.3-579s1c1
Sequence:CCGGCAGTCATGTGACCTACTTGATCTCGAGATCAAGTAGGTCACATGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177682.3-678s1c1
Sequence:CCGGGAAAGCCTAAGTGTAGTCAAACTCGAGTTTGACTACACTTAGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177682.3-958s1c1
Sequence:CCGGCGTATGAAGAGCTCCATTTAACTCGAGTTAAATGGAGCTCTTCATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177682.3-682s1c1
Sequence:CCGGGCCTAAGTGTAGTCAAATATACTCGAGTATATTTGACTACACTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177682.3-1157s1c1
Sequence:CCGGCCAGTTTAAGTTCATCTACTTCTCGAGAAGTAGATGAACTTAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198751    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177682.3-1632s1c1
Sequence:CCGGCCCTGAGGTTTCTAGATGTTACTCGAGTAACATCTAGAAACCTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198254    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177682.3-1493s1c1
Sequence:CCGGGCTCAGCAGAACATCTTTAAACTCGAGTTTAAAGATGTTCTGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198114    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177682.3-1537s1c1
Sequence:CCGGCCATTACAACTTACTGGTCATCTCGAGATGACCAGTAAGTTGTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177682.3-555s1c1
Sequence:CCGGCGGTATTTGCAGACACTACATCTCGAGATGTAGTGTCTGCAAATACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277048    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177682.3-1522s21c1
Sequence:CCGGCAACCTTTGTGTTTACCATTACTCGAGTAATGGTAAACACAAAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177682.3-885s21c1
Sequence:CCGGACTGGACCCTTGAACCTTAATCTCGAGATTAAGGTTCAAGGGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177682.3-1244s21c1
Sequence:CCGGATCCGTCCACCCAGATCTAATCTCGAGATTAGATCTGGGTGGACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177682.3-958s21c1
Sequence:CCGGCGTATGAAGAGCTCCATTTAACTCGAGTTAAATGGAGCTCTTCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177682.3-682s21c1
Sequence:CCGGGCCTAAGTGTAGTCAAATATACTCGAGTATATTTGACTACACTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177682
VALIDATED
CCZ1 MISSION shRNA shRNA Plasmid DNA
CCZ1 vacuolar protein trafficking and biogenesis associated homolog (S. cerevisiae)
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177682.3-452s1c1
Sequence:CCGGGCAGTGCTACAGCATGTACAACTCGAGTTGTACATGCTGTAGCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177682.3-579s1c1
Sequence:CCGGCAGTCATGTGACCTACTTGATCTCGAGATCAAGTAGGTCACATGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177682.3-678s1c1
Sequence:CCGGGAAAGCCTAAGTGTAGTCAAACTCGAGTTTGACTACACTTAGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177682.3-958s1c1
Sequence:CCGGCGTATGAAGAGCTCCATTTAACTCGAGTTAAATGGAGCTCTTCATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177682.3-682s1c1
Sequence:CCGGGCCTAAGTGTAGTCAAATATACTCGAGTATATTTGACTACACTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177682.3-1157s1c1
Sequence:CCGGCCAGTTTAAGTTCATCTACTTCTCGAGAAGTAGATGAACTTAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198751    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177682.3-1632s1c1
Sequence:CCGGCCCTGAGGTTTCTAGATGTTACTCGAGTAACATCTAGAAACCTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198254    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177682.3-1493s1c1
Sequence:CCGGGCTCAGCAGAACATCTTTAAACTCGAGTTTAAAGATGTTCTGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198114    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177682.3-1537s1c1
Sequence:CCGGCCATTACAACTTACTGGTCATCTCGAGATGACCAGTAAGTTGTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177682.3-555s1c1
Sequence:CCGGCGGTATTTGCAGACACTACATCTCGAGATGTAGTGTCTGCAAATACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277048    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177682.3-1522s21c1
Sequence:CCGGCAACCTTTGTGTTTACCATTACTCGAGTAATGGTAAACACAAAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177682.3-885s21c1
Sequence:CCGGACTGGACCCTTGAACCTTAATCTCGAGATTAAGGTTCAAGGGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177682.3-1244s21c1
Sequence:CCGGATCCGTCCACCCAGATCTAATCTCGAGATTAGATCTGGGTGGACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177682.3-958s21c1
Sequence:CCGGCGTATGAAGAGCTCCATTTAACTCGAGTTAAATGGAGCTCTTCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177682.3-682s21c1
Sequence:CCGGGCCTAAGTGTAGTCAAATATACTCGAGTATATTTGACTACACTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177682
VALIDATED
CCZ1 MISSION shRNA Lentiviral Transduction Particles
CCZ1 vacuolar protein trafficking and biogenesis associated homolog (S. cerevisiae)
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177682.3-452s1c1
Sequence:CCGGGCAGTGCTACAGCATGTACAACTCGAGTTGTACATGCTGTAGCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177682.3-579s1c1
Sequence:CCGGCAGTCATGTGACCTACTTGATCTCGAGATCAAGTAGGTCACATGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177682.3-678s1c1
Sequence:CCGGGAAAGCCTAAGTGTAGTCAAACTCGAGTTTGACTACACTTAGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177682.3-958s1c1
Sequence:CCGGCGTATGAAGAGCTCCATTTAACTCGAGTTAAATGGAGCTCTTCATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177682.3-682s1c1
Sequence:CCGGGCCTAAGTGTAGTCAAATATACTCGAGTATATTTGACTACACTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177682.3-1157s1c1
Sequence:CCGGCCAGTTTAAGTTCATCTACTTCTCGAGAAGTAGATGAACTTAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198751    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177682.3-1632s1c1
Sequence:CCGGCCCTGAGGTTTCTAGATGTTACTCGAGTAACATCTAGAAACCTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198254    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177682.3-1493s1c1
Sequence:CCGGGCTCAGCAGAACATCTTTAAACTCGAGTTTAAAGATGTTCTGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198114    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177682.3-1537s1c1
Sequence:CCGGCCATTACAACTTACTGGTCATCTCGAGATGACCAGTAAGTTGTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177682.3-555s1c1
Sequence:CCGGCGGTATTTGCAGACACTACATCTCGAGATGTAGTGTCTGCAAATACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277048    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177682.3-1522s21c1
Sequence:CCGGCAACCTTTGTGTTTACCATTACTCGAGTAATGGTAAACACAAAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177682.3-885s21c1
Sequence:CCGGACTGGACCCTTGAACCTTAATCTCGAGATTAAGGTTCAAGGGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177682.3-1244s21c1
Sequence:CCGGATCCGTCCACCCAGATCTAATCTCGAGATTAGATCTGGGTGGACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177682.3-958s21c1
Sequence:CCGGCGTATGAAGAGCTCCATTTAACTCGAGTTAAATGGAGCTCTTCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177682.3-682s21c1
Sequence:CCGGGCCTAAGTGTAGTCAAATATACTCGAGTATATTTGACTACACTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks