EMAIL THIS PAGE TO A FRIEND

CCZ1B

CCZ1 vacuolar protein trafficking and biogenesis associated homolog B (S. cerevisiae)

52 Gene Product Result for
Synonyms: C7orf28B H_NH0577018.2
Species: Human CCZ1B(221960)
UniProtKB ID: P86790, A2RU45, O95766, Q9UG65, Q9Y359
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4500877 Anti-CG028, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198097 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198097 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198097 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198097 Rosetta Predictions human pricing
XM_001720226 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198097 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197768 predicted 892
2 SASI_Hs01_00197769 predicted 896
3 SASI_Hs01_00197770 predicted 1174
4 SASI_Hs01_00197772 predicted 807
5 SASI_Hs01_00197773 predicted 1402
6 SASI_Hs01_00197774 predicted 1328
7 SASI_Hs01_00197775 predicted 1167
8 SASI_Hs02_00371649 predicted 1202
9 SASI_Hs01_00197776 predicted 799
10 SASI_Hs01_00197777 predicted 865
11 SASI_Hs01_00197771 predicted 533
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001720226 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00435380 predicted 581
2 SASI_Hs02_00435381 predicted 583
3 SASI_Hs02_00435382 predicted 375
4 SASI_Hs02_00435383 predicted 365
5 SASI_Hs02_00435384 predicted 578
6 SASI_Hs02_00435385 predicted 575
7 SASI_Hs02_00435386 predicted 584
8 SASI_Hs02_00435387 predicted 412
9 SASI_Hs02_00435388 predicted 371
10 SASI_Hs02_00435389 predicted 575
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198097
VALIDATED
CCZ1B MISSION shRNA Bacterial Glycerol Stock
CCZ1 vacuolar protein trafficking and biogenesis associated homolog B (S. cerevisiae)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198097.2-613s21c1
Sequence:CCGGAGCTTCTTCCCGTTGGATAAACTCGAGTTTATCCAACGGGAAGAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198097.2-345s21c1
Sequence:CCGGGGTTGTTCGGAATCCTATAATCTCGAGATTATAGGATTCCGAACAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198097.1-1272s1c1
Sequence:CCGGCGGTGACATCAACAGTGACTTCTCGAGAAGTCACTGTTGATGTCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158573    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198097.1-1593s1c1
Sequence:CCGGCTTGCTTTGAAGAATCAGATTCTCGAGAATCTGATTCTTCAAAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158946    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198097.1-1587s1c1
Sequence:CCGGGCAATACTTGCTTTGAAGAATCTCGAGATTCTTCAAAGCAAGTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198097.1-538s1c1
Sequence:CCGGGAGAAATTCTTCCATCGGTATCTCGAGATACCGATGGAAGAATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162126    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198097.1-1251s1c1
Sequence:CCGGCCCGGATTTAATGAAGATTCTCTCGAGAGAATCTTCATTAAATCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198097.1-1248s1c1
Sequence:CCGGGCACCCGGATTTAATGAAGATCTCGAGATCTTCATTAAATCCGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165023    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198097.1-1492s1c1
Sequence:CCGGGCTCACCGAGAGCATATCTAACTCGAGTTAGATATGCTCTCGGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198097.1-415s1c1
Sequence:CCGGGAGTTGTTGGACAAGGTTTATCTCGAGATAAACCTTGTCCAACAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162374    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198097.1-1538s1c1
Sequence:CCGGCATGCAAGTTAGTGGTCATATCTCGAGATATGACCACTAACTTGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198097
VALIDATED
CCZ1B MISSION shRNA shRNA Plasmid DNA
CCZ1 vacuolar protein trafficking and biogenesis associated homolog B (S. cerevisiae)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198097.2-613s21c1
Sequence:CCGGAGCTTCTTCCCGTTGGATAAACTCGAGTTTATCCAACGGGAAGAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198097.2-345s21c1
Sequence:CCGGGGTTGTTCGGAATCCTATAATCTCGAGATTATAGGATTCCGAACAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198097.1-1272s1c1
Sequence:CCGGCGGTGACATCAACAGTGACTTCTCGAGAAGTCACTGTTGATGTCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158573    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198097.1-1593s1c1
Sequence:CCGGCTTGCTTTGAAGAATCAGATTCTCGAGAATCTGATTCTTCAAAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158946    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198097.1-1587s1c1
Sequence:CCGGGCAATACTTGCTTTGAAGAATCTCGAGATTCTTCAAAGCAAGTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198097.1-538s1c1
Sequence:CCGGGAGAAATTCTTCCATCGGTATCTCGAGATACCGATGGAAGAATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162126    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198097.1-1251s1c1
Sequence:CCGGCCCGGATTTAATGAAGATTCTCTCGAGAGAATCTTCATTAAATCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198097.1-1248s1c1
Sequence:CCGGGCACCCGGATTTAATGAAGATCTCGAGATCTTCATTAAATCCGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165023    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198097.1-1492s1c1
Sequence:CCGGGCTCACCGAGAGCATATCTAACTCGAGTTAGATATGCTCTCGGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198097.1-415s1c1
Sequence:CCGGGAGTTGTTGGACAAGGTTTATCTCGAGATAAACCTTGTCCAACAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162374    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198097.1-1538s1c1
Sequence:CCGGCATGCAAGTTAGTGGTCATATCTCGAGATATGACCACTAACTTGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198097
VALIDATED
CCZ1B MISSION shRNA Lentiviral Transduction Particles
CCZ1 vacuolar protein trafficking and biogenesis associated homolog B (S. cerevisiae)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198097.2-613s21c1
Sequence:CCGGAGCTTCTTCCCGTTGGATAAACTCGAGTTTATCCAACGGGAAGAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198097.2-345s21c1
Sequence:CCGGGGTTGTTCGGAATCCTATAATCTCGAGATTATAGGATTCCGAACAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198097.1-1272s1c1
Sequence:CCGGCGGTGACATCAACAGTGACTTCTCGAGAAGTCACTGTTGATGTCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158573    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198097.1-1593s1c1
Sequence:CCGGCTTGCTTTGAAGAATCAGATTCTCGAGAATCTGATTCTTCAAAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158946    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198097.1-1587s1c1
Sequence:CCGGGCAATACTTGCTTTGAAGAATCTCGAGATTCTTCAAAGCAAGTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198097.1-538s1c1
Sequence:CCGGGAGAAATTCTTCCATCGGTATCTCGAGATACCGATGGAAGAATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162126    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198097.1-1251s1c1
Sequence:CCGGCCCGGATTTAATGAAGATTCTCTCGAGAGAATCTTCATTAAATCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198097.1-1248s1c1
Sequence:CCGGGCACCCGGATTTAATGAAGATCTCGAGATCTTCATTAAATCCGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165023    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198097.1-1492s1c1
Sequence:CCGGGCTCACCGAGAGCATATCTAACTCGAGTTAGATATGCTCTCGGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198097.1-415s1c1
Sequence:CCGGGAGTTGTTGGACAAGGTTTATCTCGAGATAAACCTTGTCCAACAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162374    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198097.1-1538s1c1
Sequence:CCGGCATGCAAGTTAGTGGTCATATCTCGAGATATGACCACTAACTTGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks