EMAIL THIS PAGE TO A FRIEND

CD101

CD101 molecule

76 Gene Product Result for
Synonyms: EWI-101 IGSF2 V7
UniProtKB ID: Q93033, Q15856
Gene ID:
Mouse(630146) CD101 antigen
Rat(310727) CD101 molecule
naked mole-rat(101720206) CD101 molecule
sheep(101106981) CD101 molecule
chicken(418450) CD101 molecule
domestic cat(101090035) CD101 molecule
cow(509609) CD101 molecule
Horse(100066219) CD101 molecule
dog(475810) CD101 molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004258 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004258 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004258 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001099332 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001099332 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001099332 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004258 Rosetta Predictions human pricing
XM_001066340 Rosetta Predictions rat pricing
XM_227554 Rosetta Predictions rat pricing
NM_001099332 Rosetta Predictions mouse pricing
XM_903217 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004258 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041360 predicted 2807
2 SASI_Hs02_00337206 predicted 1640
3 SASI_Hs02_00337207 predicted 698
4 SASI_Hs01_00041361 predicted 1724
5 SASI_Hs01_00041362 predicted 2496
6 SASI_Hs02_00337208 predicted 2207
7 SASI_Hs01_00041363 predicted 510
8 SASI_Hs02_00337209 predicted 1897
9 SASI_Hs02_00337210 predicted 224
10 SASI_Hs01_00041365 predicted 1830
11 SASI_Hs01_00041357 predicted 1778
12 SASI_Hs01_00041358 predicted 371
13 SASI_Hs01_00041359 predicted 919
14 SASI_Hs01_00041364 predicted 1550
15 SASI_Hs01_00041366 predicted 555
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066340 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00317105 predicted 1329
2 SASI_Rn02_00317106 predicted 475
3 SASI_Rn02_00317107 predicted 1699
4 SASI_Rn02_00317108 predicted 1625
5 SASI_Rn02_00317109 predicted 1343
6 SASI_Rn02_00317110 predicted 1639
7 SASI_Rn02_00317111 predicted 2021
8 SASI_Rn02_00317112 predicted 723
9 SASI_Rn02_00317113 predicted 1298
10 SASI_Rn02_00317114 predicted 553
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227554 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384472 predicted 1633
2 SASI_Rn02_00384473 predicted 1562
3 SASI_Rn02_00384474 predicted 676
4 SASI_Rn02_00384475 predicted 382
5 SASI_Rn02_00384476 predicted 1649
6 SASI_Rn02_00384477 predicted 942
7 SASI_Rn02_00384478 predicted 1602
8 SASI_Rn02_00384479 predicted 767
9 SASI_Rn02_00384480 predicted 1390
10 SASI_Rn02_00384481 predicted 1741
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099332 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301797 predicted 1590
2 SASI_Mm02_00301798 predicted 1748
3 SASI_Mm02_00301799 predicted 1630
4 SASI_Mm02_00301800 predicted 706
5 SASI_Mm02_00301801 predicted 2318
6 SASI_Mm02_00301802 predicted 1960
7 SASI_Mm02_00301803 predicted 2091
8 SASI_Mm02_00301804 predicted 2251
9 SASI_Mm02_00301805 predicted 2132
10 SASI_Mm02_00301806 predicted 1995
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903217 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00267188 predicted 1666
2 SASI_Mm01_00267189 predicted 1681
3 SASI_Mm01_00267190 predicted 1557
4 SASI_Mm01_00267191 predicted 1759
5 SASI_Mm01_00267192 predicted 678
6 SASI_Mm01_00267193 predicted 1882
7 SASI_Mm01_00267194 predicted 251
8 SASI_Mm01_00267195 predicted 1896
9 SASI_Mm01_00267196 predicted 1527
10 SASI_Mm01_00267197 predicted 595
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004258
CD101 MISSION shRNA Bacterial Glycerol Stock
CD101 molecule
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004258.1-652s1c1
Sequence:CCGGCCCTTGTATACAGAGCGGTTTCTCGAGAAACCGCTCTGTATACAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004258.1-1860s1c1
Sequence:CCGGGACGAAAGTGTCGCAGTCTTTCTCGAGAAAGACTGCGACACTTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004258.1-772s1c1
Sequence:CCGGGCAACGGAATGGATTCAGGATCTCGAGATCCTGAATCCATTCCGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004258.1-58s1c1
Sequence:CCGGCTTCTGACTAAGCTCAGCATTCTCGAGAATGCTGAGCTTAGTCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004258.1-1092s1c1
Sequence:CCGGCAAGGCTTTCTCTCTCAAGATCTCGAGATCTTGAGAGAGAAAGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004258.1-967s1c1
Sequence:CCGGCAAGGCATTTGGTTCTTCAATCTCGAGATTGAAGAACCAAATGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004258.1-1795s1c1
Sequence:CCGGCTTATTCGAATCACCCACAATCTCGAGATTGTGGGTGATTCGAATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153115    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004258.1-3176s1c1
Sequence:CCGGGCAACTTCTAGATGAACCCAACTCGAGTTGGGTTCATCTAGAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004258.3-460s21c1
Sequence:CCGGCAGTGCAAAGACTAATCTAATCTCGAGATTAGATTAGTCTTTGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004258.3-1701s21c1
Sequence:CCGGGTCAGCCGCAAGTGATGTTAACTCGAGTTAACATCACTTGCGGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004258.3-293s21c1
Sequence:CCGGGCCTTCTCTTACGCAGTATATCTCGAGATATACTGCGTAAGAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004258.3-2320s21c1
Sequence:CCGGGAAGGTTTCCCAAGACTTATTCTCGAGAATAAGTCTTGGGAAACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004258
CD101 MISSION shRNA shRNA Plasmid DNA
CD101 molecule
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004258.1-652s1c1
Sequence:CCGGCCCTTGTATACAGAGCGGTTTCTCGAGAAACCGCTCTGTATACAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004258.1-1860s1c1
Sequence:CCGGGACGAAAGTGTCGCAGTCTTTCTCGAGAAAGACTGCGACACTTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004258.1-772s1c1
Sequence:CCGGGCAACGGAATGGATTCAGGATCTCGAGATCCTGAATCCATTCCGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004258.1-58s1c1
Sequence:CCGGCTTCTGACTAAGCTCAGCATTCTCGAGAATGCTGAGCTTAGTCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004258.1-1092s1c1
Sequence:CCGGCAAGGCTTTCTCTCTCAAGATCTCGAGATCTTGAGAGAGAAAGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004258.1-967s1c1
Sequence:CCGGCAAGGCATTTGGTTCTTCAATCTCGAGATTGAAGAACCAAATGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004258.1-1795s1c1
Sequence:CCGGCTTATTCGAATCACCCACAATCTCGAGATTGTGGGTGATTCGAATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153115    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004258.1-3176s1c1
Sequence:CCGGGCAACTTCTAGATGAACCCAACTCGAGTTGGGTTCATCTAGAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004258.3-460s21c1
Sequence:CCGGCAGTGCAAAGACTAATCTAATCTCGAGATTAGATTAGTCTTTGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004258.3-1701s21c1
Sequence:CCGGGTCAGCCGCAAGTGATGTTAACTCGAGTTAACATCACTTGCGGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004258.3-293s21c1
Sequence:CCGGGCCTTCTCTTACGCAGTATATCTCGAGATATACTGCGTAAGAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004258.3-2320s21c1
Sequence:CCGGGAAGGTTTCCCAAGACTTATTCTCGAGAATAAGTCTTGGGAAACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004258
CD101 MISSION shRNA Lentiviral Transduction Particles
CD101 molecule
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004258.1-652s1c1
Sequence:CCGGCCCTTGTATACAGAGCGGTTTCTCGAGAAACCGCTCTGTATACAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004258.1-1860s1c1
Sequence:CCGGGACGAAAGTGTCGCAGTCTTTCTCGAGAAAGACTGCGACACTTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004258.1-772s1c1
Sequence:CCGGGCAACGGAATGGATTCAGGATCTCGAGATCCTGAATCCATTCCGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004258.1-58s1c1
Sequence:CCGGCTTCTGACTAAGCTCAGCATTCTCGAGAATGCTGAGCTTAGTCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004258.1-1092s1c1
Sequence:CCGGCAAGGCTTTCTCTCTCAAGATCTCGAGATCTTGAGAGAGAAAGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004258.1-967s1c1
Sequence:CCGGCAAGGCATTTGGTTCTTCAATCTCGAGATTGAAGAACCAAATGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004258.1-1795s1c1
Sequence:CCGGCTTATTCGAATCACCCACAATCTCGAGATTGTGGGTGATTCGAATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153115    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004258.1-3176s1c1
Sequence:CCGGGCAACTTCTAGATGAACCCAACTCGAGTTGGGTTCATCTAGAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004258.3-460s21c1
Sequence:CCGGCAGTGCAAAGACTAATCTAATCTCGAGATTAGATTAGTCTTTGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004258.3-1701s21c1
Sequence:CCGGGTCAGCCGCAAGTGATGTTAACTCGAGTTAACATCACTTGCGGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004258.3-293s21c1
Sequence:CCGGGCCTTCTCTTACGCAGTATATCTCGAGATATACTGCGTAAGAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004258.3-2320s21c1
Sequence:CCGGGAAGGTTTCCCAAGACTTATTCTCGAGAATAAGTCTTGGGAAACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099332
CD101 MISSION shRNA Bacterial Glycerol Stock
CD101 molecule
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099332.1-1741s21c1
Sequence:CCGGGGAGCCTTTCATCGGCTTATTCTCGAGAATAAGCCGATGAAAGGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099332.1-1897s21c1
Sequence:CCGGCGGTGTACAGTGGAGGTTTATCTCGAGATAAACCTCCACTGTACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099332.1-1959s21c1
Sequence:CCGGTGCCACCTCTAACCTATTAATCTCGAGATTAATAGGTTAGAGGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099332.1-2738s21c1
Sequence:CCGGTGGAGGATGCTGGGATATATTCTCGAGAATATATCCCAGCATCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099332.1-148s21c1
Sequence:CCGGCAGGATTTCCGGTGGTCTATTCTCGAGAATAGACCACCGGAAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099332
CD101 MISSION shRNA shRNA Plasmid DNA
CD101 molecule
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099332.1-1741s21c1
Sequence:CCGGGGAGCCTTTCATCGGCTTATTCTCGAGAATAAGCCGATGAAAGGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099332.1-1897s21c1
Sequence:CCGGCGGTGTACAGTGGAGGTTTATCTCGAGATAAACCTCCACTGTACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099332.1-1959s21c1
Sequence:CCGGTGCCACCTCTAACCTATTAATCTCGAGATTAATAGGTTAGAGGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099332.1-2738s21c1
Sequence:CCGGTGGAGGATGCTGGGATATATTCTCGAGAATATATCCCAGCATCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099332.1-148s21c1
Sequence:CCGGCAGGATTTCCGGTGGTCTATTCTCGAGAATAGACCACCGGAAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099332
CD101 MISSION shRNA Lentiviral Transduction Particles
CD101 molecule
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099332.1-1741s21c1
Sequence:CCGGGGAGCCTTTCATCGGCTTATTCTCGAGAATAAGCCGATGAAAGGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099332.1-1897s21c1
Sequence:CCGGCGGTGTACAGTGGAGGTTTATCTCGAGATAAACCTCCACTGTACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099332.1-1959s21c1
Sequence:CCGGTGCCACCTCTAACCTATTAATCTCGAGATTAATAGGTTAGAGGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099332.1-2738s21c1
Sequence:CCGGTGGAGGATGCTGGGATATATTCTCGAGAATATATCCCAGCATCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099332.1-148s21c1
Sequence:CCGGCAGGATTTCCGGTGGTCTATTCTCGAGAATAGACCACCGGAAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks