EMAIL THIS PAGE TO A FRIEND

CD109

CD109 molecule

111 Gene Product Result for
Synonyms: CPAMD7 RP11-525G3.1
Gene ID:
Human(135228) Summary: This gene encodes a member of the alpha2-macroglobulin/complement superfamily. The encoded GPI-linked glycoprotein is found on the cell surface of platelets, activated T-cells, and endothelial cells. The protein binds to and negatively regulates signaling of transforming growth factor beta (TGF-beta). Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Apr 2009]
Mouse(235505) CD109 antigen
Rat(363104) CD109 molecule
Zebrafish(569058) CD109 molecule
cow(534043) CD109 molecule
Horse(100068163) CD109 molecule
domestic cat(101098303) CD109 molecule
dog(474970) CD109 molecule
chicken(421862) CD109 molecule
sheep(101117513) CD109 molecule
naked mole-rat(101721921) CD109 molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1321 Human CD109 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153098 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153098 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153098 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_133493 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133493 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133493 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_133493 Rosetta Predictions human pricing
NM_001108771 Rosetta Predictions rat pricing
NM_153098 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133493 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173897 predicted 3560
2 SASI_Hs01_00173898 predicted 679
3 SASI_Hs01_00173900 predicted 1891
4 SASI_Hs02_00363217 predicted 996
5 SASI_Hs01_00173901 predicted 3778
6 SASI_Hs01_00173902 predicted 823
7 SASI_Hs01_00173903 predicted 2364
8 SASI_Hs02_00363218 predicted 1052
9 SASI_Hs02_00363219 predicted 4365
10 SASI_Hs02_00363220 predicted 3027
11 SASI_Hs01_00173896 predicted 3841
12 SASI_Hs01_00173899 predicted 2691
13 SASI_Hs01_00173904 predicted 564
14 SASI_Hs01_00173905 predicted 3256
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108771 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241915 predicted 3438
2 SASI_Rn02_00241916 predicted 2964
3 SASI_Rn02_00241917 predicted 3638
4 SASI_Rn02_00241918 predicted 3345
5 SASI_Rn02_00241919 predicted 3451
6 SASI_Rn02_00241920 predicted 3350
7 SASI_Rn02_00241921 predicted 3289
8 SASI_Rn02_00241922 predicted 2332
9 SASI_Rn02_00241923 predicted 4092
10 SASI_Rn02_00241924 predicted 4329
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153098 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130711 predicted 674
2 SASI_Mm01_00130712 predicted 1343
3 SASI_Mm02_00342948 predicted 483
4 SASI_Mm01_00130713 predicted 2683
5 SASI_Mm01_00130715 predicted 3102
6 SASI_Mm01_00130716 predicted 2051
7 SASI_Mm01_00130717 predicted 2041
8 SASI_Mm01_00130718 predicted 3537
9 SASI_Mm01_00130719 predicted 346
10 SASI_Mm01_00130720 predicted 3528
11 SASI_Mm01_00130714 predicted 2439
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153098
VALIDATED
CD109 MISSION shRNA Bacterial Glycerol Stock
CD109 molecule
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000334152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153098.2-844s21c1
Sequence:CCGGGCTCCGTCATAGCAAAGTATACTCGAGTATACTTTGCTATGACGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153098.2-3871s21c1
Sequence:CCGGGCCAGCTTAATGTTGACTATACTCGAGTATAGTCAACATTAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153098.2-1695s21c1
Sequence:CCGGGCCTGTATAATCGCATATTATCTCGAGATAATATGCGATTATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334089    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153098.2-5403s21c1
Sequence:CCGGCCAGTGATGCTGTAAGTCATTCTCGAGAATGACTTACAGCATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_153098.2-5403s1c1
Sequence:CCGGCCAGTGATGCTGTAAGTCATTCTCGAGAATGACTTACAGCATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_153098.2-1695s1c1
Sequence:CCGGGCCTGTATAATCGCATATTATCTCGAGATAATATGCGATTATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_153098.2-3871s1c1
Sequence:CCGGGCCAGCTTAATGTTGACTATACTCGAGTATAGTCAACATTAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_153098.2-3361s1c1
Sequence:CCGGCGGACAATTATACCTTAGCAACTCGAGTTGCTAAGGTATAATTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_153098.2-844s1c1
Sequence:CCGGGCTCCGTCATAGCAAAGTATACTCGAGTATACTTTGCTATGACGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153098
VALIDATED
CD109 MISSION shRNA shRNA Plasmid DNA
CD109 molecule
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000334152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153098.2-844s21c1
Sequence:CCGGGCTCCGTCATAGCAAAGTATACTCGAGTATACTTTGCTATGACGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153098.2-3871s21c1
Sequence:CCGGGCCAGCTTAATGTTGACTATACTCGAGTATAGTCAACATTAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153098.2-1695s21c1
Sequence:CCGGGCCTGTATAATCGCATATTATCTCGAGATAATATGCGATTATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334089    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153098.2-5403s21c1
Sequence:CCGGCCAGTGATGCTGTAAGTCATTCTCGAGAATGACTTACAGCATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_153098.2-5403s1c1
Sequence:CCGGCCAGTGATGCTGTAAGTCATTCTCGAGAATGACTTACAGCATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_153098.2-1695s1c1
Sequence:CCGGGCCTGTATAATCGCATATTATCTCGAGATAATATGCGATTATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_153098.2-3871s1c1
Sequence:CCGGGCCAGCTTAATGTTGACTATACTCGAGTATAGTCAACATTAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_153098.2-3361s1c1
Sequence:CCGGCGGACAATTATACCTTAGCAACTCGAGTTGCTAAGGTATAATTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_153098.2-844s1c1
Sequence:CCGGGCTCCGTCATAGCAAAGTATACTCGAGTATACTTTGCTATGACGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153098
VALIDATED
CD109 MISSION shRNA Lentiviral Transduction Particles
CD109 molecule
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000334152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153098.2-844s21c1
Sequence:CCGGGCTCCGTCATAGCAAAGTATACTCGAGTATACTTTGCTATGACGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153098.2-3871s21c1
Sequence:CCGGGCCAGCTTAATGTTGACTATACTCGAGTATAGTCAACATTAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153098.2-1695s21c1
Sequence:CCGGGCCTGTATAATCGCATATTATCTCGAGATAATATGCGATTATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334089    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153098.2-5403s21c1
Sequence:CCGGCCAGTGATGCTGTAAGTCATTCTCGAGAATGACTTACAGCATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_153098.2-5403s1c1
Sequence:CCGGCCAGTGATGCTGTAAGTCATTCTCGAGAATGACTTACAGCATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_153098.2-1695s1c1
Sequence:CCGGGCCTGTATAATCGCATATTATCTCGAGATAATATGCGATTATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_153098.2-3871s1c1
Sequence:CCGGGCCAGCTTAATGTTGACTATACTCGAGTATAGTCAACATTAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_153098.2-3361s1c1
Sequence:CCGGCGGACAATTATACCTTAGCAACTCGAGTTGCTAAGGTATAATTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_153098.2-844s1c1
Sequence:CCGGGCTCCGTCATAGCAAAGTATACTCGAGTATACTTTGCTATGACGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133493
VALIDATED
CD109 MISSION shRNA Bacterial Glycerol Stock
CD109 molecule
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_133493.1-224s1c1
Sequence:CCGGCCCGGAGGAAATGTGACTATTCTCGAGAATAGTCACATTTCCTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_133493.1-3107s1c1
Sequence:CCGGGCCGATCCTTACATAGATATTCTCGAGAATATCTATGTAAGGATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_133493.1-5097s1c1
Sequence:CCGGGCAGTACATTTACTGTGCTTTCTCGAGAAAGCACAGTAAATGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_133493.1-3695s1c1
Sequence:CCGGGCAGCCCTAATGAATACAGAACTCGAGTTCTGTATTCATTAGGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133493.1-472s1c1
Sequence:CCGGCCGCTTATCATTTGAGACCAACTCGAGTTGGTCTCAAATGATAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133493
VALIDATED
CD109 MISSION shRNA shRNA Plasmid DNA
CD109 molecule
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_133493.1-224s1c1
Sequence:CCGGCCCGGAGGAAATGTGACTATTCTCGAGAATAGTCACATTTCCTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_133493.1-3107s1c1
Sequence:CCGGGCCGATCCTTACATAGATATTCTCGAGAATATCTATGTAAGGATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_133493.1-5097s1c1
Sequence:CCGGGCAGTACATTTACTGTGCTTTCTCGAGAAAGCACAGTAAATGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_133493.1-3695s1c1
Sequence:CCGGGCAGCCCTAATGAATACAGAACTCGAGTTCTGTATTCATTAGGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133493.1-472s1c1
Sequence:CCGGCCGCTTATCATTTGAGACCAACTCGAGTTGGTCTCAAATGATAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133493
VALIDATED
CD109 MISSION shRNA Lentiviral Transduction Particles
CD109 molecule
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_133493.1-224s1c1
Sequence:CCGGCCCGGAGGAAATGTGACTATTCTCGAGAATAGTCACATTTCCTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_133493.1-3107s1c1
Sequence:CCGGGCCGATCCTTACATAGATATTCTCGAGAATATCTATGTAAGGATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_133493.1-5097s1c1
Sequence:CCGGGCAGTACATTTACTGTGCTTTCTCGAGAAAGCACAGTAAATGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_133493.1-3695s1c1
Sequence:CCGGGCAGCCCTAATGAATACAGAACTCGAGTTCTGTATTCATTAGGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133493.1-472s1c1
Sequence:CCGGCCGCTTATCATTTGAGACCAACTCGAGTTGGTCTCAAATGATAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks