EMAIL THIS PAGE TO A FRIEND

CD14

CD14 molecule

105 Gene Product Result for
UniProtKB ID: P08571, Q53XT5, Q96FR6, Q96L99, Q9UNS3
Gene ID:
Human(929) Summary: The protein encoded by this gene is a surface antigen that is preferentially expressed on monocytes/macrophages. It cooperates with other proteins to mediate the innate immune response to bacterial lipopolysaccharide. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Mar 2010]
Mouse(12475) CD14 antigen
Rat(60350) CD14 molecule
chicken(100194427) CD14 molecule
dog(607076) CD14 molecule
Horse(100034125) CD14 molecule-like
cow(281048) CD14 molecule
Horse(100630219) CD14 molecule
domestic cat(101096132) CD14 molecule
Goat(100861226) CD14 molecule
sheep(443216) CD14 molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301719 Anti-CD14 affinity isolated antibody human, mouse
immunohistochemistry, western blot pricing
GW22783 Anti-CD14 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB2500215 Anti-CD14 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB1405579 Anti-CD14 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA001887 Anti-CD14 antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA002127 Anti-CD14 antibody produced in rabbit Ab3, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB5500040 Anti-CD14 antibody, Rabbit monoclonal clone SP192, recombinant, expressed in proprietary host, affinity isolated antibody human (tested)
immunohistochemistry, western blot pricing
AMAB90897 Monoclonal Anti-CD14 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL1637, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AMAB90898 Monoclonal Anti-CD14 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL1638, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry pricing
C7673 Monoclonal Anti-CD14 antibody produced in mouse clone UCHM-1, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700097 Monoclonal Anti-CD14 antibody produced in mouse clone MEM-15, purified immunoglobulin, buffered aqueous solution human, nonhuman primates
flow cytometry pricing
SAB4700103 Monoclonal Anti-CD14 antibody produced in mouse clone MEM-18, purified immunoglobulin, buffered aqueous solution human, nonhuman primates
flow cytometry pricing
SAB4700669 Monoclonal Anti-CD14 antibody produced in mouse clone B-A8, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700102 Monoclonal Anti-CD14, low endotoxin antibody produced in mouse clone MEM-18, purified immunoglobulin, buffered aqueous solution nonhuman primates, human
flow cytometry pricing
SAB4700098 Monoclonal Anti-CD14-APC antibody produced in mouse clone MEM-15, purified immunoglobulin, buffered aqueous solution nonhuman primates, human
flow cytometry pricing
SAB4700104 Monoclonal Anti-CD14-APC antibody produced in mouse clone MEM-18, purified immunoglobulin, buffered aqueous solution nonhuman primates, human
flow cytometry pricing
SAB4700099 Monoclonal Anti-CD14-Biotin antibody produced in mouse clone MEM-15, purified immunoglobulin, buffered aqueous solution nonhuman primates, human
flow cytometry pricing
SAB4700105 Monoclonal Anti-CD14-Biotin antibody produced in mouse clone MEM-18, purified immunoglobulin, buffered aqueous solution nonhuman primates, human
flow cytometry pricing
SAB4700100 Monoclonal Anti-CD14-FITC antibody produced in mouse clone MEM-15, purified immunoglobulin, buffered aqueous solution human, nonhuman primates
flow cytometry pricing
SAB4700106 Monoclonal Anti-CD14-FITC antibody produced in mouse clone MEM-18, purified immunoglobulin, buffered aqueous solution human, nonhuman primates
flow cytometry pricing
SAB4700101 Monoclonal Anti-CD14-PE antibody produced in mouse clone MEM-15, purified immunoglobulin, buffered aqueous solution human, nonhuman primates
flow cytometry pricing
SAB4700107 Monoclonal Anti-CD14-PE antibody produced in mouse clone MEM-18, purified immunoglobulin, buffered aqueous solution nonhuman primates, human
flow cytometry pricing
P5435 Monoclonal Anti-CD14−PE antibody produced in mouse clone UCHM-1, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
F8527 Monoclonal Anti-CD45−FITC/CD14-PE DUAL-TAG antibody produced in mouse clone BRA-55/UCHM-1, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009841 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009841 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009841 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000591 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000591 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000591 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000591 Rosetta Predictions human pricing
NM_001040021 Rosetta Predictions human pricing
NM_021744 Rosetta Predictions rat pricing
NM_009841 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000591 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217106 predicted 773
2 SASI_Hs01_00217107 predicted 540
3 SASI_Hs01_00217108 predicted 592
4 SASI_Hs01_00217109 predicted 444
5 SASI_Hs01_00217111 predicted 690
6 SASI_Hs02_00302862 predicted 532
7 SASI_Hs01_00217112 predicted 599
8 SASI_Hs02_00302863 predicted 691
9 SASI_Hs02_00302864 predicted 949
10 SASI_Hs02_00302865 predicted 774
11 SASI_Hs01_00217103 predicted 1236
12 SASI_Hs01_00217104 predicted 869
13 SASI_Hs01_00217105 predicted 940
14 SASI_Hs01_00217110 predicted 1329
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040021 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185051 predicted 678
2 SASI_Hs01_00185052 predicted 446
3 SASI_Hs01_00185053 predicted 495
4 SASI_Hs01_00185054 predicted 349
5 SASI_Hs01_00185056 predicted 601
6 SASI_Hs02_00308761 predicted 446
7 SASI_Hs01_00185057 predicted 502
8 SASI_Hs02_00308762 predicted 596
9 SASI_Hs02_00308763 predicted 852
10 SASI_Hs02_00308764 predicted 674
11 SASI_Hs01_00185048 predicted 1150
12 SASI_Hs01_00185049 predicted 771
13 SASI_Hs01_00185050 predicted 846
14 SASI_Hs01_00185055 predicted 1240
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021744 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262772 predicted 892
2 SASI_Rn02_00262773 predicted 539
3 SASI_Rn02_00262774 predicted 268
4 SASI_Rn02_00262775 predicted 949
5 SASI_Rn02_00262776 predicted 563
6 SASI_Rn02_00262777 predicted 832
7 SASI_Rn02_00262778 predicted 1077
8 SASI_Rn02_00262779 predicted 1029
9 SASI_Rn02_00262780 predicted 315
10 SASI_Rn02_00262781 predicted 950
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009841 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037144 predicted 656
2 SASI_Mm01_00037145 predicted 439
3 SASI_Mm02_00317199 predicted 663
4 SASI_Mm02_00317200 predicted 600
5 SASI_Mm01_00037151 predicted 568
6 SASI_Mm02_00317201 predicted 774
7 SASI_Mm02_00317202 predicted 679
8 SASI_Mm02_00317203 predicted 911
9 SASI_Mm02_00317204 predicted 740
10 SASI_Mm01_00037143 predicted 903
11 SASI_Mm01_00037146 predicted 354
12 SASI_Mm01_00037147 predicted 1033
13 SASI_Mm01_00037148 predicted 1114
14 SASI_Mm01_00037149 predicted 282
15 SASI_Mm01_00037150 predicted 232
16 SASI_Mm01_00037152 predicted 655
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009841
VALIDATED
CD14 MISSION shRNA Bacterial Glycerol Stock
CD14 molecule
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009841.2-449s1c1
Sequence:CCGGCGGATTCCTAGTCGGATTCTACTCGAGTAGAATCCGACTAGGAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009841.2-241s1c1
Sequence:CCGGCGAGGAAAGTTGTTCCTGCAACTCGAGTTGCAGGAACAACTTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009841.2-685s1c1
Sequence:CCGGCCAAGCACACTCACTCAACTTCTCGAGAAGTTGAGTGAGTGTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009841.2-751s1c1
Sequence:CCGGCCTGTCTGACAATCCTGAATTCTCGAGAATTCAGGATTGTCAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009841.2-909s1c1
Sequence:CCGGGACTAGACCTTAGTCACAATTCTCGAGAATTGTGACTAAGGTCTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306484    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009841.3-1303s21c1
Sequence:CCGGCAACGAATCCTCTGCTTTAAACTCGAGTTTAAAGCAGAGGATTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009841.3-1150s21c1
Sequence:CCGGATCCCACTCGGAGAAGTTTAACTCGAGTTAAACTTCTCCGAGTGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000354230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009841.3-449s21c1
Sequence:CCGGCGGATTCCTAGTCGGATTCTACTCGAGTAGAATCCGACTAGGAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009841.3-406s21c1
Sequence:CCGGTATCAAGTCTCTGTCCTTAAACTCGAGTTTAAGGACAGAGACTTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009841.3-972s21c1
Sequence:CCGGGTCAGCTAAACTCGCTCAATCCTCGAGGATTGAGCGAGTTTAGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009841
VALIDATED
CD14 MISSION shRNA shRNA Plasmid DNA
CD14 molecule
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009841.2-449s1c1
Sequence:CCGGCGGATTCCTAGTCGGATTCTACTCGAGTAGAATCCGACTAGGAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009841.2-241s1c1
Sequence:CCGGCGAGGAAAGTTGTTCCTGCAACTCGAGTTGCAGGAACAACTTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009841.2-685s1c1
Sequence:CCGGCCAAGCACACTCACTCAACTTCTCGAGAAGTTGAGTGAGTGTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009841.2-751s1c1
Sequence:CCGGCCTGTCTGACAATCCTGAATTCTCGAGAATTCAGGATTGTCAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009841.2-909s1c1
Sequence:CCGGGACTAGACCTTAGTCACAATTCTCGAGAATTGTGACTAAGGTCTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306484    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009841.3-1303s21c1
Sequence:CCGGCAACGAATCCTCTGCTTTAAACTCGAGTTTAAAGCAGAGGATTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009841.3-1150s21c1
Sequence:CCGGATCCCACTCGGAGAAGTTTAACTCGAGTTAAACTTCTCCGAGTGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000354230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009841.3-449s21c1
Sequence:CCGGCGGATTCCTAGTCGGATTCTACTCGAGTAGAATCCGACTAGGAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009841.3-406s21c1
Sequence:CCGGTATCAAGTCTCTGTCCTTAAACTCGAGTTTAAGGACAGAGACTTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009841.3-972s21c1
Sequence:CCGGGTCAGCTAAACTCGCTCAATCCTCGAGGATTGAGCGAGTTTAGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009841
VALIDATED
CD14 MISSION shRNA Lentiviral Transduction Particles
CD14 molecule
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009841.2-449s1c1
Sequence:CCGGCGGATTCCTAGTCGGATTCTACTCGAGTAGAATCCGACTAGGAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009841.2-241s1c1
Sequence:CCGGCGAGGAAAGTTGTTCCTGCAACTCGAGTTGCAGGAACAACTTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009841.2-685s1c1
Sequence:CCGGCCAAGCACACTCACTCAACTTCTCGAGAAGTTGAGTGAGTGTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009841.2-751s1c1
Sequence:CCGGCCTGTCTGACAATCCTGAATTCTCGAGAATTCAGGATTGTCAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009841.2-909s1c1
Sequence:CCGGGACTAGACCTTAGTCACAATTCTCGAGAATTGTGACTAAGGTCTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306484    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009841.3-1303s21c1
Sequence:CCGGCAACGAATCCTCTGCTTTAAACTCGAGTTTAAAGCAGAGGATTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009841.3-1150s21c1
Sequence:CCGGATCCCACTCGGAGAAGTTTAACTCGAGTTAAACTTCTCCGAGTGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000354230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009841.3-449s21c1
Sequence:CCGGCGGATTCCTAGTCGGATTCTACTCGAGTAGAATCCGACTAGGAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009841.3-406s21c1
Sequence:CCGGTATCAAGTCTCTGTCCTTAAACTCGAGTTTAAGGACAGAGACTTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009841.3-972s21c1
Sequence:CCGGGTCAGCTAAACTCGCTCAATCCTCGAGGATTGAGCGAGTTTAGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000591
CD14 MISSION shRNA Bacterial Glycerol Stock
CD14 molecule
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000591.1-189s1c1
Sequence:CCGGCCTTGTGAGCTGGACGATGAACTCGAGTTCATCGTCCAGCTCACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000591.1-494s1c1
Sequence:CCGGCCTAAAGATAACCGGCACCATCTCGAGATGGTGCCGGTTATCTTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000591.1-711s1c1
Sequence:CCGGAGCCTAGACCTGTCTGACAATCTCGAGATTGTCAGACAGGTCTAGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000591.1-321s1c1
Sequence:CCGGCCGTTTCTAAAGCGCGTCGATCTCGAGATCGACGCGCTTTAGAAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000591.1-1008s1c1
Sequence:CCGGGCCAAGCTCAGAGTGCTCGATCTCGAGATCGAGCACTCTGAGCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000591.2-1265s21c1
Sequence:CCGGTCAGCTGCAACAGACTGAACACTCGAGTGTTCAGTCTGTTGCAGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000591.2-1370s21c1
Sequence:CCGGCCCACGAGGGCTCAATGAACTCTCGAGAGTTCATTGAGCCCTCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000591.2-1320s21c1
Sequence:CCGGTAACCTGACACTGGACGGGAACTCGAGTTCCCGTCCAGTGTCAGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000591
CD14 MISSION shRNA shRNA Plasmid DNA
CD14 molecule
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000591.1-189s1c1
Sequence:CCGGCCTTGTGAGCTGGACGATGAACTCGAGTTCATCGTCCAGCTCACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000591.1-494s1c1
Sequence:CCGGCCTAAAGATAACCGGCACCATCTCGAGATGGTGCCGGTTATCTTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000591.1-711s1c1
Sequence:CCGGAGCCTAGACCTGTCTGACAATCTCGAGATTGTCAGACAGGTCTAGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000591.1-321s1c1
Sequence:CCGGCCGTTTCTAAAGCGCGTCGATCTCGAGATCGACGCGCTTTAGAAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000591.1-1008s1c1
Sequence:CCGGGCCAAGCTCAGAGTGCTCGATCTCGAGATCGAGCACTCTGAGCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000591.2-1265s21c1
Sequence:CCGGTCAGCTGCAACAGACTGAACACTCGAGTGTTCAGTCTGTTGCAGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000591.2-1370s21c1
Sequence:CCGGCCCACGAGGGCTCAATGAACTCTCGAGAGTTCATTGAGCCCTCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000591.2-1320s21c1
Sequence:CCGGTAACCTGACACTGGACGGGAACTCGAGTTCCCGTCCAGTGTCAGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000591
CD14 MISSION shRNA Lentiviral Transduction Particles
CD14 molecule
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000591.1-189s1c1
Sequence:CCGGCCTTGTGAGCTGGACGATGAACTCGAGTTCATCGTCCAGCTCACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000591.1-494s1c1
Sequence:CCGGCCTAAAGATAACCGGCACCATCTCGAGATGGTGCCGGTTATCTTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000591.1-711s1c1
Sequence:CCGGAGCCTAGACCTGTCTGACAATCTCGAGATTGTCAGACAGGTCTAGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000591.1-321s1c1
Sequence:CCGGCCGTTTCTAAAGCGCGTCGATCTCGAGATCGACGCGCTTTAGAAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000591.1-1008s1c1
Sequence:CCGGGCCAAGCTCAGAGTGCTCGATCTCGAGATCGAGCACTCTGAGCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000591.2-1265s21c1
Sequence:CCGGTCAGCTGCAACAGACTGAACACTCGAGTGTTCAGTCTGTTGCAGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000591.2-1370s21c1
Sequence:CCGGCCCACGAGGGCTCAATGAACTCTCGAGAGTTCATTGAGCCCTCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000591.2-1320s21c1
Sequence:CCGGTAACCTGACACTGGACGGGAACTCGAGTTCCCGTCCAGTGTCAGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks