EMAIL THIS PAGE TO A FRIEND

CD151

CD151 molecule (Raph blood group)

115 Gene Product Result for
Synonyms: GP27 MER2 PETA-3 RAPH SFA1 TSPAN24
UniProtKB ID: P48509, A8KAK8, E9PI15, Q14826, Q86U54, Q96TE3
Gene ID:
Human(977) Summary: The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein that is known to complex with integrins and other transmembrane 4 superfamily proteins. It is involved in cellular processes including cell adhesion and may regulate integrin trafficking and/or function. This protein enhances cell motility, invasion and metastasis of cancer cells. Multiple alternatively spliced transcript variants that encode the same protein have been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(12476) CD151 antigen
Rat(64315) CD151 molecule (Raph blood group)
domestic guinea pig(100716404) CD151 molecule (Raph blood group)
naked mole-rat(101700427) CD151 molecule (Raph blood group)
Zebrafish(450020) CD151 molecule
chicken(423105) CD151 molecule (Raph blood group)
cow(523328) CD151 molecule (Raph blood group)
domestic cat(101098337) CD151 molecule (Raph blood group)
dog(475992) CD151 molecule (Raph blood group)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009842 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009842 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009842 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004357 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004357 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004357 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039490 Rosetta Predictions human pricing
NM_004357 Rosetta Predictions human pricing
NM_139029 Rosetta Predictions human pricing
NM_139030 Rosetta Predictions human pricing
NM_022523 Rosetta Predictions rat pricing
NM_001111049 Rosetta Predictions mouse pricing
NM_001111050 Rosetta Predictions mouse pricing
NM_009842 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039490 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188401 predicted 571
2 SASI_Hs01_00188402 predicted 410
3 SASI_Hs01_00188403 predicted 661
4 SASI_Hs01_00188404 predicted 630
5 SASI_Hs01_00188405 predicted 574
6 SASI_Hs01_00188406 predicted 451
7 SASI_Hs01_00188407 predicted 865
8 SASI_Hs01_00188408 predicted 829
9 SASI_Hs01_00188409 predicted 796
10 SASI_Hs02_00308533 predicted 332
11 SASI_Hs01_00188410 predicted 643
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004357 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131799 predicted 631
2 SASI_Hs01_00131800 predicted 473
3 SASI_Hs01_00131801 predicted 721
4 SASI_Hs01_00131802 predicted 694
5 SASI_Hs01_00131803 predicted 636
6 SASI_Hs01_00131804 predicted 522
7 SASI_Hs01_00131805 predicted 935
8 SASI_Hs01_00131806 predicted 894
9 SASI_Hs01_00131807 predicted 864
10 SASI_Hs02_00337423 predicted 396
11 SASI_Hs01_00131808 predicted 714
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139029 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136882 predicted 634
2 SASI_Hs01_00136883 predicted 473
3 SASI_Hs01_00136884 predicted 720
4 SASI_Hs01_00136885 predicted 684
5 SASI_Hs01_00136886 predicted 633
6 SASI_Hs01_00136887 predicted 521
7 SASI_Hs01_00136888 predicted 932
8 SASI_Hs01_00136889 predicted 891
9 SASI_Hs01_00136890 predicted 866
10 SASI_Hs02_00364083 predicted 392
11 SASI_Hs01_00136891 predicted 712
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139030 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150895 predicted 570
2 SASI_Hs01_00150896 predicted 419
3 SASI_Hs01_00150897 predicted 658
4 SASI_Hs01_00150898 predicted 632
5 SASI_Hs01_00150899 predicted 572
6 SASI_Hs01_00150900 predicted 454
7 SASI_Hs01_00150901 predicted 868
8 SASI_Hs01_00150902 predicted 827
9 SASI_Hs01_00150903 predicted 805
10 SASI_Hs02_00364084 predicted 341
11 SASI_Hs01_00150904 predicted 647
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022523 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055869 predicted 1201
2 SASI_Rn01_00055870 predicted 307
3 SASI_Rn01_00055871 predicted 1380
4 SASI_Rn01_00055872 predicted 1107
5 SASI_Rn01_00055873 predicted 1230
6 SASI_Rn01_00055874 predicted 1007
7 SASI_Rn01_00055875 predicted 446
8 SASI_Rn01_00055876 predicted 1118
9 SASI_Rn01_00055877 predicted 1215
10 SASI_Rn01_00055878 predicted 424
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111049 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306195 predicted 437
2 SASI_Mm02_00306196 predicted 828
3 SASI_Mm02_00306197 predicted 619
4 SASI_Mm02_00306198 predicted 925
5 SASI_Mm02_00306199 predicted 561
6 SASI_Mm02_00306200 predicted 781
7 SASI_Mm02_00306201 predicted 662
8 SASI_Mm02_00306202 predicted 498
9 SASI_Mm02_00306203 predicted 683
10 SASI_Mm02_00306204 predicted 993
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111050 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306205 predicted 309
2 SASI_Mm02_00306206 predicted 699
3 SASI_Mm02_00306207 predicted 494
4 SASI_Mm02_00306208 predicted 805
5 SASI_Mm02_00306209 predicted 436
6 SASI_Mm02_00306210 predicted 651
7 SASI_Mm02_00306211 predicted 537
8 SASI_Mm02_00306212 predicted 370
9 SASI_Mm02_00306213 predicted 556
10 SASI_Mm02_00306214 predicted 863
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009842 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317205 predicted 556
2 SASI_Mm01_00174048 predicted 941
3 SASI_Mm01_00174049 predicted 736
4 SASI_Mm02_00317206 predicted 1049
5 SASI_Mm02_00317207 predicted 677
6 SASI_Mm02_00317208 predicted 897
7 SASI_Mm02_00317209 predicted 780
8 SASI_Mm02_00317210 predicted 618
9 SASI_Mm02_00317211 predicted 802
10 SASI_Mm02_00317212 predicted 1105
11 SASI_Mm01_00174050 predicted 916
12 SASI_Mm01_00174051 predicted 376
13 SASI_Mm01_00174052 predicted 459
14 SASI_Mm01_00174053 predicted 373
15 SASI_Mm01_00174054 predicted 654
16 SASI_Mm01_00174055 predicted 369
17 SASI_Mm01_00174056 predicted 451
18 SASI_Mm01_00174057 predicted 915
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009842
CD151 MISSION shRNA Bacterial Glycerol Stock
CD151 molecule (Raph blood group)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009842.3-1111s21c1
Sequence:CCGGACACTACTGACCACGATGATGCTCGAGCATCATCGTGGTCAGTAGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009842.3-1153s21c1
Sequence:CCGGGCACTACTGACCACGATGATGCTCGAGCATCATCGTGGTCAGTAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009842.3-740s21c1
Sequence:CCGGGACACCATGGTCAAGAGATACCTCGAGGTATCTCTTGACCATGGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009842.1-1346s1c1
Sequence:CCGGCCTGCCTGTAGAATAGGGTTTCTCGAGAAACCCTATTCTACAGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009842.1-915s1c1
Sequence:CCGGCCATGCCTCCAACATCTATAACTCGAGTTATAGATGTTGGAGGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009842.1-371s1c1
Sequence:CCGGGCCTCAAGTACCTGCTCTTTACTCGAGTAAAGAGCAGGTACTTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009842.1-455s1c1
Sequence:CCGGCCCTCAAGAGTGACTACATTACTCGAGTAATGTAGTCACTCTTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009842.1-1026s1c1
Sequence:CCGGGCAGGTCTTCAGCATGATCTTCTCGAGAAGATCATGCTGAAGACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009842
CD151 MISSION shRNA shRNA Plasmid DNA
CD151 molecule (Raph blood group)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009842.3-1111s21c1
Sequence:CCGGACACTACTGACCACGATGATGCTCGAGCATCATCGTGGTCAGTAGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009842.3-1153s21c1
Sequence:CCGGGCACTACTGACCACGATGATGCTCGAGCATCATCGTGGTCAGTAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009842.3-740s21c1
Sequence:CCGGGACACCATGGTCAAGAGATACCTCGAGGTATCTCTTGACCATGGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009842.1-1346s1c1
Sequence:CCGGCCTGCCTGTAGAATAGGGTTTCTCGAGAAACCCTATTCTACAGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009842.1-915s1c1
Sequence:CCGGCCATGCCTCCAACATCTATAACTCGAGTTATAGATGTTGGAGGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009842.1-371s1c1
Sequence:CCGGGCCTCAAGTACCTGCTCTTTACTCGAGTAAAGAGCAGGTACTTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009842.1-455s1c1
Sequence:CCGGCCCTCAAGAGTGACTACATTACTCGAGTAATGTAGTCACTCTTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009842.1-1026s1c1
Sequence:CCGGGCAGGTCTTCAGCATGATCTTCTCGAGAAGATCATGCTGAAGACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009842
CD151 MISSION shRNA Lentiviral Transduction Particles
CD151 molecule (Raph blood group)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009842.3-1111s21c1
Sequence:CCGGACACTACTGACCACGATGATGCTCGAGCATCATCGTGGTCAGTAGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009842.3-1153s21c1
Sequence:CCGGGCACTACTGACCACGATGATGCTCGAGCATCATCGTGGTCAGTAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009842.3-740s21c1
Sequence:CCGGGACACCATGGTCAAGAGATACCTCGAGGTATCTCTTGACCATGGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009842.1-1346s1c1
Sequence:CCGGCCTGCCTGTAGAATAGGGTTTCTCGAGAAACCCTATTCTACAGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009842.1-915s1c1
Sequence:CCGGCCATGCCTCCAACATCTATAACTCGAGTTATAGATGTTGGAGGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009842.1-371s1c1
Sequence:CCGGGCCTCAAGTACCTGCTCTTTACTCGAGTAAAGAGCAGGTACTTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009842.1-455s1c1
Sequence:CCGGCCCTCAAGAGTGACTACATTACTCGAGTAATGTAGTCACTCTTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009842.1-1026s1c1
Sequence:CCGGGCAGGTCTTCAGCATGATCTTCTCGAGAAGATCATGCTGAAGACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004357
VALIDATED
CD151 MISSION shRNA Bacterial Glycerol Stock
CD151 molecule (Raph blood group)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000300331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004357.4-272s21c1
Sequence:CCGGCCCTCAAGAGTGACTACATCACTCGAGTGATGTAGTCACTCTTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004357.4-197s21c1
Sequence:CCGGACCTGCTGTTTACCTACAATTCTCGAGAATTGTAGGTAAACAGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004357.4-450s21c1
Sequence:CCGGGCTGGAGATCATCGCTGGTATCTCGAGATACCAGCGATGATCTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004357.4-992s21c1
Sequence:CCGGACCCTGTGCCATCACCATAACCTCGAGGTTATGGTGATGGCACAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004357.4-728s21c1
Sequence:CCGGGAGACCATGCCTCCAACATCTCTCGAGAGATGTTGGAGGCATGGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004357.4-1152s21c1
Sequence:GTACCGGTGGTCAGATGCAGGTTGGAAGCTCGAGCTTCCAACCTGCATCTGACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004357.4-1387s21c1
Sequence:GTACCGGGCAGTCACCACCACCCGAAATCTCGAGATTTCGGGTGGTGGTGACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004357.3-164s1c1
Sequence:CCGGGCCTCAAGTACCTGCTGTTTACTCGAGTAAACAGCAGGTACTTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004357.3-819s1c1
Sequence:CCGGGCAGGTCTTTGGCATGATCTTCTCGAGAAGATCATGCCAAAGACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004357.3-426s1c1
Sequence:CCGGGCTGGAGATCATCGCTGGTATCTCGAGATACCAGCGATGATCTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004357.3-173s1c1
Sequence:CCGGACCTGCTGTTTACCTACAATTCTCGAGAATTGTAGGTAAACAGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004357.3-248s1c1
Sequence:CCGGCCCTCAAGAGTGACTACATCACTCGAGTGATGTAGTCACTCTTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004357
VALIDATED
CD151 MISSION shRNA shRNA Plasmid DNA
CD151 molecule (Raph blood group)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000300331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004357.4-272s21c1
Sequence:CCGGCCCTCAAGAGTGACTACATCACTCGAGTGATGTAGTCACTCTTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004357.4-197s21c1
Sequence:CCGGACCTGCTGTTTACCTACAATTCTCGAGAATTGTAGGTAAACAGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004357.4-450s21c1
Sequence:CCGGGCTGGAGATCATCGCTGGTATCTCGAGATACCAGCGATGATCTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004357.4-992s21c1
Sequence:CCGGACCCTGTGCCATCACCATAACCTCGAGGTTATGGTGATGGCACAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004357.4-728s21c1
Sequence:CCGGGAGACCATGCCTCCAACATCTCTCGAGAGATGTTGGAGGCATGGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004357.4-1152s21c1
Sequence:GTACCGGTGGTCAGATGCAGGTTGGAAGCTCGAGCTTCCAACCTGCATCTGACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004357.4-1387s21c1
Sequence:GTACCGGGCAGTCACCACCACCCGAAATCTCGAGATTTCGGGTGGTGGTGACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004357.3-164s1c1
Sequence:CCGGGCCTCAAGTACCTGCTGTTTACTCGAGTAAACAGCAGGTACTTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004357.3-819s1c1
Sequence:CCGGGCAGGTCTTTGGCATGATCTTCTCGAGAAGATCATGCCAAAGACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004357.3-426s1c1
Sequence:CCGGGCTGGAGATCATCGCTGGTATCTCGAGATACCAGCGATGATCTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004357.3-173s1c1
Sequence:CCGGACCTGCTGTTTACCTACAATTCTCGAGAATTGTAGGTAAACAGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004357.3-248s1c1
Sequence:CCGGCCCTCAAGAGTGACTACATCACTCGAGTGATGTAGTCACTCTTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004357
VALIDATED
CD151 MISSION shRNA Lentiviral Transduction Particles
CD151 molecule (Raph blood group)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000300331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004357.4-272s21c1
Sequence:CCGGCCCTCAAGAGTGACTACATCACTCGAGTGATGTAGTCACTCTTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004357.4-197s21c1
Sequence:CCGGACCTGCTGTTTACCTACAATTCTCGAGAATTGTAGGTAAACAGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004357.4-450s21c1
Sequence:CCGGGCTGGAGATCATCGCTGGTATCTCGAGATACCAGCGATGATCTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004357.4-992s21c1
Sequence:CCGGACCCTGTGCCATCACCATAACCTCGAGGTTATGGTGATGGCACAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004357.4-728s21c1
Sequence:CCGGGAGACCATGCCTCCAACATCTCTCGAGAGATGTTGGAGGCATGGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004357.4-1152s21c1
Sequence:GTACCGGTGGTCAGATGCAGGTTGGAAGCTCGAGCTTCCAACCTGCATCTGACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004357.4-1387s21c1
Sequence:GTACCGGGCAGTCACCACCACCCGAAATCTCGAGATTTCGGGTGGTGGTGACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004357.3-164s1c1
Sequence:CCGGGCCTCAAGTACCTGCTGTTTACTCGAGTAAACAGCAGGTACTTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004357.3-819s1c1
Sequence:CCGGGCAGGTCTTTGGCATGATCTTCTCGAGAAGATCATGCCAAAGACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004357.3-426s1c1
Sequence:CCGGGCTGGAGATCATCGCTGGTATCTCGAGATACCAGCGATGATCTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004357.3-173s1c1
Sequence:CCGGACCTGCTGTTTACCTACAATTCTCGAGAATTGTAGGTAAACAGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004357.3-248s1c1
Sequence:CCGGCCCTCAAGAGTGACTACATCACTCGAGTGATGTAGTCACTCTTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)